S/MARt DB - S/MAR

AC  SM0000001
XX
DT  1.1.1999 00:00:00 (created); ili
DT  8.12.2004 12:49:00 (updated); ili2
XX
NA  MOUSE$kappa-MAR
XX
OS  mouse, Mus spec.
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
HO  human, rabbit [2]
XX
SZ  371 bp
XX
DE  G000538; immunoglobulin kappa light chain
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; 
DC  between joining and constant regions [1]; ~200 bp
DC  upstream of the kappa enhancer [1]
XX
SQ  AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA
SQ  TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA
SQ  ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA
SQ  AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG
SQ  AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG
SQ  TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT
SQ  ACTTTAGAGTC
SC  [7]
XX
FT  2 - 11: cleavage by topoisomerase II [3]
FT  2 - 15: deleted in plasmacytoma PC 7183 [3]
FT  5 - 14: cleavage by topoisomerase II [3]
FT  5 - 14: 5'-recombination junction [3]
FT  8 - 17: cleavage by topoisomerase II [3]
FT  10 - 19: cleavage by topoisomerase II [3]
FT  32 - 41: cleavage by topoisomerase II [3]
FT  53 - 62: cleavage by Drosophila topoisomerase II only
FT             [3]
FT  68 - 77: cleavage by topoisomerase II [3]
FT  69 - 78: cleavage by topoisomerase II [3]
FT  73 - 82: cleavage by topoisomerase II [3]
FT  98 - 107: cleavage by Drosophila topoisomerase II only
FT              [3]
FT  147 - 156: cleavage by topoisomerase II [3]
FT  163 - 284: confers MAR-like features upon any DNA when
FT               contiguously reiterated in the same molecule
FT               [7]
FT  164 - 170: similar motif found in human PARP MAR
FT               SM0000116 [8]
FT  182 - 191: cleavage by topoisomerase II [3]
FT  189 - 198: cleavage by topoisomerase II [3]
FT  219 - 228: cleavage by topoisomerase II [3]
FT  242 - 251: cleavage by topoisomerase II [3]
FT  248 - 257: cleavage by topoisomerase II [3]
FT  253 - 253: G in [3]
FT  256 - 265: cleavage by topoisomerase II [3]
XX
SF  topoisomerase II sites [1]; AT-rich sites [1];
SF  contains a breakpoint for chromosomal translocation [3];
SF  several short stretches of homopolymeric adenine or
SF  thymine [7]
XX
BP  75% [J. Bode, direct submission]; 20% [7]
TP  constitutive [1]
XX
FF  prototype of a S/MAR; contributes to maximal expression of
FF  the kappa gene [2]; contributes to hypermutation [9];
FF  contributes to kappa expression as shown by flow cytometic
FF  assay, but has little effect on accumulation of the
FF  respective mRNA [9]
XX
CP  liver, kidney, spleen, thymus, MPC-11, P-815, L-cell [1]
XX
EV  in vitro selection of S/MAR 
EC  [J. Bode, direct submission]
XX
BF  SB000002; lamin A [6]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [6]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000004; lamin C [6]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000018; SP120 [4]
MM  nitrocellulose filter binding; 
SO  brain; rat
QA  6
BF  SB000018; SP120 [4]
MM  southwestern blotting; 
SO  brain; rat
QA  6
BF  SB000022; topoisomerase II [3]
MM  gel retardation; 
SO  Drosophila; Drosophila melanogaster
QA  6
BF  SB000022; topoisomerase II [3]
MM  topoisomerase II cleavage assay; 
SO  Drosophila; Drosophila melanogaster
QA  6
BF  SB000043; topoisomerase II [3]
MM  topoisomerase II cleavage assay; 
SO  calf; calf
QA  6
BF  SB000045; SMI1 [5]
MM  functional analysis; 
PR  254 bp fragment
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000052; topoisomerase II [3]
MM  topoisomerase II cleavage assay; 
SO  mouse; mouse
QA  6
BF  SB000053; topoisomerase II [3]
MM  nitrocellulose filter binding; 
SO  HeLa; human
QA  6
BF  SB000067; SMAR1 [10]
MM  gel shift competition; 
SO  rec(mouse-E.coli); mouse
QA  6
BF  SB000077; SAF-A [12]
MM  supershift (antibody binding); 
SO  liver; mouse
QA  6
BF  SB000077; SAF-A [12]
MM  southwestern blotting; 
SO  liver; mouse
QA  6
XX
RN  [1]
RX  MEDLINE; 86106203 PubMed; 3002631
RA  Cockerill, P. N., Garrard, W. T.
RT  Chromosomal loop anchorage of the kappa immunoglobin gene
RT  occurs next to the enhancer in a region containing
RT  topoisomerase II sites
RL  Cell 44:273-282 (1986)
RN  [2]
RX  MEDLINE; 90078219 PubMed; 2512290
RA  Blasquez, V. C., Xu, M., Moses, S. C., Garrard, W. T.
RT  Immunoglobulin kappa gene expression after stable
RT  integration. I. Role of the intronic MAR and enhancer in
RT  plasmacytoma cells
RL  J. Biol. Chem. 264:21183-21189 (1989)
RN  [3]
RX  MEDLINE; 89315824 PubMed; 2546156
RA  Sperry, A. O., Blasquez, V. C., Garrard, W. T.
RT  Dysfunction of chromosomal llop attachment sites:
RT  Illegitimate recombination linked to matrix association
RT  regions and topoisomerase II
RL  Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989)
RN  [4]
RX  MEDLINE; 93286136 PubMed; 8509422
RA  Tsutsui, K., Tsutsui, K., Okada, S., Watarai, S., Seki, S.,
RA  Yasuda, T., Shohmori, T.
RT  Identification and characterization of a nuclear scaffold
RT  protein that binds the matrix attachment region DNA
RL  J. Biol. Chem. 268:12886-12894 (1993)
RN  [5]
RX  MEDLINE; 93296190 PubMed; 8516310
RA  Fishel, B. R., Sperry, A. O., Garrard, W. T.
RT  Yeast calmodulin and a conserved nuclear protein
RT  participate in the in vivo binding of a matrix associated
RT  region
RL  Proc. Natl. Acad. Sci. USA 90:5623-5627 (1993)
RN  [6]
RX  MEDLINE; 94344140 PubMed; 8065361
RA  Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B.,
RA  Compton, D. A., van Driel, R.
RT  Binding of matrix attachment regions to lamin polymers
RT  involves single-stranded regions and the minor groove
RL  Mol. Cell. Biol. 14:6297-6305 (1994)
RN  [7]
RX  MEDLINE; 96222527 PubMed; 8670229
RA  Okada, S., Tsutsui, K., Tsutsui, K., Seki, S., Shohmori, T.
RT  Subdomain structure of the matrix attachment region located
RT  within the mouse immunoglobulin kappa gene intron
RL  Biochem. Biophys. Res. Commun. 222:472-477 (1996)
RN  [8]
RA  Boulikas, T., Kong, C. F., Brooks, D., Hsie, L.
RT  The 3' untranslated region of the human
RT  poly(ADP-ribose)polymerase gene is a nuclear matrix
RT  anchoring site
RL  Int. J. Oncol. 9:1287-1294 (1996)
RN  [9]
RX  MEDLINE; 97377037 PubMed; 9233808
RA  Goyenechea, B., Klix, N., Williams, G. T., Riddell, A.,
RA  Neuberger, M. S., Milstein, C.
RT  Cells strongly expressing Ig kappa transgenes show clonal
RT  recruitment of hypermutation: a role for both MAR and the
RT  enhancers
RL  EMBO J. 16:3987-3994 (1997)
RN  [10]
RX  MEDLINE; 20408892 PubMed; 10950932
RA  Chattopadhyay, S., Kaul, R., Charest, A., Housman, D.,
RA  Chen, J.
RT  SMAR1, a novel, alternatively spliced gene product, binds
RT  the scaffold/matrix-associated region at the T cell
RT  receptor beta locus
RL  Genomics 68:93-96 (2000)
RN  [11]
RX  MEDLINE; 20496822 PubMed; 11041885
RA  Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi,
RA  M., Meshi, T.
RT  AHM1, a novel type of nuclear matrix-localized, MAR binding
RT  protein with a single AT hook and a J
RT  domain-homologous region
RL  Plant Cell 12:1903-1916 (2000)
RN  [12]
RX  MEDLINE; 21456956 PubMed; 11573239
RA  Lobov, I. B., Tsutsui, K., Mitchell, A. R., Podgornaya, O.
RA  I.
RT  Specificity of SAF-A and lamin B binding in vitro
RT  correlates with the satellite DNA bending state
RL  J. Cell. Biochem. 83:218-229 (2001)
//