S/MARt DB - S/MAR

AC  SM0000002
XX
DT  1.1.1999 00:00:00 (created); ili
DT  2.8.2004 15:26:00 (updated); ili2
XX
NA  HS$IFNB1-E
XX
SY  HSSARD, huIFN-beta SAR (I), huIFN-beta SAR (1), SAR 2200, SAR 800, 800 bp human beta-interferon SAR, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2206 bp
XX
LO  9p22
DE  G000308; interferon-beta 1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; 
XX
SQ  GAATTCAGCAAGGTCGCCACGCACAAGATCAATATTAACAATCAGTCATCTCTCTTTAGC
SQ  AATAAAAAGGTGAAAAATTACATTTTAAAAATGACACCATAGACGATGTATGAAAATAAT
SQ  CTACTTGGAAATAAATCTAGGCAAAGAAGTGCAAGACTGTTACCCAGAAAACTTACAAAT
SQ  TGTAAATGAGAGGTTAGTGAAGATTTAAATGAATGAAGATCTAAATAAACTTATAAATTG
SQ  TGAGAGAAATTAATGAATGTCTAAGTTAATGCAGAAACGGAGAGACATACTATATTCATG
SQ  AACTAAAAGACTTAATATTGTGAAGGTATACTTTCTTTTCACATAAATTTGTAGTCAATA
SQ  TGTTCACCCCAAAAAAGCTGTTTGTTAACTTGTCAACCTCATTTCAAAATGTATATAGAA
SQ  AGCCCAAAGACAATAACAAAAATATTCTTGTAGAACAAAATGGGAAAGAATGTTCCACTA
SQ  AATATCAAGATTTAGAGCAAAGCATGAGATGTGTGGGGATAGACAGTGAGGCTGATAAAA
SQ  TAGAGTAGAGCTCAGAAACAGACCCATTGATATATGTAAGTGACCTATGAAAAAAATATG
SQ  GCATTTTACAATGGGAAAATGATGATCTTTTTCTTTTTTAGAAAAACAGGGAAATATATT
SQ  TATATGTAAAAAATAAAAGGGAACCCATATGTCATACCATACACACAAAAAAATTCCAGT
SQ  GAATTATAAGTCTAAATGGAGAAGGCAAAACTTTAAATCTTTTAGAAAATAATATAGAAG
SQ  CATGCCATCATGACTTCAGTGTAGAGAAAAATTTCTTATGACTCAAAGTCCTAACCACAA
SQ  AGAAAAGATTGTTAATTAGATTGCATGAATATTAAGACTTATTTTTAAAATTAAAAAACC
SQ  ATTAAGAAAAGTCAGGCCATAGAATGACAGAAAATATTTGCAACACCCCAGTAAAGAGAA
SQ  TTGTAATATGCAGATTATAAAAAGAAGTCTTACAAATCAGTAAAAAATAAAACTAGACAA
SQ  AAATTTGAACAGATGAAAGAGAAACTCTAAATAATCATTACACATGAGAAACTCAATCTC
SQ  AGAAATCAGAGAACTATCATTGCATATACACTAAATTAGAGAAATATTAAAAGGCTAAGT
SQ  AACATCTGTGGCAATATTGATGGTATATAACCTTGATATGATGTGATGAGAACAGTACTT
SQ  TACCCCATGGGCTTCCTCCCCAAACCCTTACCCCAGTATAAATCATGACAAATATACTTT
SQ  AAAAACCATTACCCTATATCTAACCAGTACTCCTCAAAACTGTCAAGGTCATCAAAAATA
SQ  AGAAAAGTCTGAGGAACTGTCAAAACTAAGAGGAACCCAAGGAGACATGAGAATTATATG
SQ  TAATGTGGCATTCTGAATGAGATCCCAGAACAGAAAAAGAACAGTAGCTAAAAAACTAAT
SQ  GAAATATAAATAAAGTTTGAACTTTAGTTTTTTTTAAAAAAGAGTAGCATTAACACGGCA
SQ  AAGTCATTTTCATATTTTTCTTGAACATTAAGTACAAGTCTATAATTAAAAATTTTTTAA
SQ  ATGTAGTCTGGAACATTGCCAGAAACAGAAGTACAGCAGCTATCTGTGCTGTCGCCTAAC
SQ  TATCCATAGCTGATTGGTCTAAAATGAGATACATCAACGCTCCTCCATGTTTTTTGTTTT
SQ  CTTTTTAAATGAAAAACTTTATTTTTTAAGAGGAGTTTCAGGTTCATAGCAAAATTGAGA
SQ  GGAAGGTACATTCAAGCTGAGGAAGTTTTCCTCTATTCCTAGTTTACTGAGAGATTGCAT
SQ  CATGAATGGGTGTTAAATTTTGTCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTG
SQ  ATTTTCTTCTTTAACCTGTTGATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAAC
SQ  CACCCTTACATATCTGGAATAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTC
SQ  TTGGATTCTTTTTGCTAATATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATAT
SQ  TGGTCTGTTGTTTTCTTTTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCT
SQ  GGCCTAGTTGAATGATTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTA
SQ  GAAAGTTGATACAATTTTTTTTTCTTTAAATATCTTGATAGAATTC
SC  [J. Bode, direct submission]
XX
FT  2001 - 2200: scaffold-attached region
XX
SF  fragment (centre) of a strong S/MAR 5' to IFNB1 SM0000534
SF  [1]; contains repetitive sequences, several ATATTT boxes
SF  and motifs related to the Drosophila topoisomerase II site
SF  [1]; displays an extended base-unpairing region over its
SF  entire length [3]
XX
BP  87-93% [J. Bode, direct submission]; 89-99% [5]
XX
FF  in a vector containing the SV40 ORI as well it ensures the
FF  episomal state of the vector [4] [5]; may enable
FF  co-replication during cellular DNA replication and
FF  maintenance of a stable copy number between generations in
FF  a vector construct containing also the SV40 ORI [13651,
FF  14289]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from murine L-cells
EV  in vivo selection of S/MAR [1]
XX
BF  SB000087; SAF-A [6]
MM  cis-platinium crosslinking; 
PR  pEPI-1 [6]
SO  CHO; chinese hamster
QA  6
BF  SB000088; H1 [5]
MM  southwestern blotting; 
PR  pEPI-1
SO  CHO; chinese hamster
QA  6
XX
DR  EMBL: M83137; HSSARD
DR  EMBL: AL390882; AL390882
XX
RN  [1]
RX  MEDLINE; 89000669 PubMed; 2844236
RA  Bode, J., Maass, K.
RT  Chromatin domain surrounding the human interferon-beta gene
RT  as defined by scaffold-attached regions
RL  Biochemistry 27:4706-4711 (1988)
RN  [2]
RX  MEDLINE; 91027762 PubMed; 2223779
RA  Mielke, C., Kohwi, Y., Kohwi-Shigematsu, T., Bode, J.
RT  Hierarchical binding of DNA fragments derived from
RT  scaffold-attached regions: correlation of properties in
RT  vitro and function in vivo
RL  Biochemistry 29:7475-7485 (1990)
RN  [3]
RX  MEDLINE; 98062364 PubMed; 9398526
RA  Benham, C., Kohwi-Shigematsu, T., Bode, J.
RT  Stress-induced duplex DNA destabilization in
RT  scaffold/matrix attachment regions
RL  J. Mol. Biol. 274:181-196 (1997)
RN  [4]
RX  MEDLINE; 99081837 PubMed; 9862961
RA  Piechaczek, C., Fetzer, C., Baiker, A., Bode, J., Lipps, H.
RA  J.
RT  A vector based on the SV40 origin of replication and
RT  chromosomal S/MARs replicates episomally in CHO cells
RL  Nucleic Acids Res. 27:426-428 (1999)
RN  [5]
RX  MEDLINE; 20173880 PubMed; 10707091
RA  Baiker, A., Maercker, C., Piechaczek, C., Schmidt, S. B.,
RA  Bode, J., Benham, C., Lipps, H. J.
RT  Mitotic stability of an episomal vector containing a human
RT  scaffold/matrix-attached region is provided by association
RT  with nuclear matrix
RL  Nat. Cell Biol. 2:182-184 (2000)
RN  [6]
RX  MEDLINE; 21940443 PubMed; 11897664
RA  Jenke, B. H. C., Fetzer, C. P., Stehle, I. M., Joensson,
RA  F., Fackelmayer, F. O., Conradt, H., Bode, J., Lipps, H. J.
RT  An episomally replicating vector binds to the nuclear
RT  matrix protein SAF-A in vivo
RL  EMBO Rep. 3:349-354 (2002)
//