S/MARt DB - S/MAR

AC  SM0000003
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$IFNA2-5MAR2
XX
SY  SAR3-5, IFNA2-SAR3, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1783 bp
XX
LO  9p21-p22
DE  G001235; interferon alpha 2, IFNA2
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; 
DC  there are several S/MARs upstream to the IFNA2 gene; this
DC  (SAR3) is the 2nd
XX
SQ  GGATCCAGCCTGACCTTGTAAAATAGCCTAACGTGTGTTCCCTAGTTTCCTCATCTTTGA
SQ  TGTGGGGACAATATGTATTTTTTTCCATAGGATTATTGTAAGGATTAAATGAGTAAATAC
SQ  CCAAAGGCATCAAAGTATGCCTACTAAAGTAATTAGGACTGTTAGAAGTCAGAGTAGCTA
SQ  CCTCAGGGAAGAAACAAGAAAGCGGGTTTTAAGTAGTGACATATTGGCAACACTCAGGAG
SQ  GCTTCTAGGTCTGAGAAAATCTTTTATTTTTCACACAGGTGGTAGTTTCAGAGTGCATTC
SQ  AGTGTATGAATATCATTGTGCTATATGCCTAAGATACTTGCAATTTCTGTGTATTATACT
SQ  TTTTCTTTTCTTTTTTGTTTTTAAGATGGAATCTCACTCTGTTGCCCTGGTGGGAGTGCA
SQ  GTAGCATGATCATAACTCACTGCAGTCTCAAACTCCTGGGCTCAAGCAATCCTCCTGCCT
SQ  CTTACCTCAGCCTCCTGATTAGCTGGGGTTACAGGCATGTGATAGCACATCTGGCTCTGT
SQ  TATTTTCATGGTAAAAAAATACCACAATATGTGTAATTATATATATTTGTCTGCTATGTA
SQ  TATAGATTTGTCTGCTATGGCTGTGTCCCATTTGGCCCTCTAAAAAGTTGTTCATGCTTG
SQ  TGCTCTAAAAAAGACAAGATTCAGCTTTTTGAGAATCTGTTCCATATGGCTAAATGTTTT
SQ  CAAAAAACTGGTTTTGTAAAAATGTTCTAATGAAGAGTTGATTCATTGTGACATCTCTTT
SQ  TATTCCAAAGAATCCTTTTAAAATTTTCCATGCATACGTTTTATCAGTAATACATGTAAT
SQ  CAAATATTAGCACCTCAAAAATATATTCAAAGACTTTGTAAAACTCAAACAAAACTTGTG
SQ  ACCATGAAGTTTTGATGTTTCATCATGTTTCCTAAAATAGAAAGTTTACAAAATCTTTCA
SQ  ATCTCCTAAGTTACTAGATGATGCTTACAGAAGCAATAAAATCAGAGAAACAAAAATGTT
SQ  AGAAAATTCTTGCAGGTGATTTTCAATATTGTTTTATTTTGTGCAAAAAATAATTAACCT
SQ  TTTAGAAGGTCCCAGAGTATTAGAAGCCCAAACTCTGGAATATTCTCAATTTTAGTTGAG
SQ  CTTTTCAGTTATTATAATATTGTATAGCTACTCATATAATTAGTAATACAAAAGATTCTG
SQ  AGTCTTATTTGTAAATAAAGTTCAAAATAAGTCATATGTTATATGTTATAGGTAATCATG
SQ  TTAGATATAAACCACTATTGAAAAAGATATAAAAACAAAATAACTTTATTTTTTGTTATC
SQ  ATATATATAGTCCATTATGTTCACATTTAGAATGATGTTAACAATTGTTTTGACATTTTT
SQ  AAAATGAAAAACTCATATATCTAGTTCATGAAATTGTTAATAAACTAGAAAATATATGGA
SQ  CATAAAAATGACATTAGCCAAGATATGATAATGAGGCAATGGTGGCAGGGTACACAAGGC
SQ  ATAAAAGCCATTATTTCCCACCCAAAATGTTATGTCACATTTGTGCCTTACTCAGCTATA
SQ  ATTTATGTAAAAATCTGATTTGTGAATTAAGATAACTTTTTAAAAGATTGTACAAAGGTA
SQ  TATCTACATTTTTGAATTCAACTAGAGATGGGAATTATCATGTCGTATTAACCACTACAT
SQ  TAAAAACACTTAAGGATATCTAGGGCATAAAAATAAAAATCGATGTAATGGCACTTAAGA
SQ  TATGTATTAAGCAGTAAATGATACCAATGCAAACCTGCATTAT
SC  EMBL #U82705; nt 1-1783
XX
SF  A-tracts ranging from 6-12 bp in length [1]
XX
BP  79% [1]; 80% [J. Bode, direct submission]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: U82705; HSU82705
XX
RN  [1]
RX  MEDLINE; 98140121 PubMed; 9479494
RA  Strissel, P. L., Dann, H. A., Pomykala, H. M., Diaz, M. O.,
RA  Rowley, J. D., Olopade, O. I.
RT  Scaffold-associated regions in the human type I interferon
RT  gene cluster on the short arm of chromosome 9
RL  Genomics 47:217-229 (1998)
//