S/MARt DB - S/MAR

AC  SM0000006
XX
DT  1.1.1999 00:00:00 (created); ili
DT  2.8.2004 17:26:00 (updated); ili2
XX
NA  HS$IFNB1-K
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  646 bp
XX
LO  9p22
DE  G000308; interferon-beta 1
DP  Direction: 3'; Pos 1: ATG
DC  directly adjacent to the coding sequence [1]
XX
SQ  CTGCTCTAGGAAAAAATGCCTAGATACAAATAAAGACTTTTATGATGCTTCTCTTTGAAC
SQ  TTCTTTTTAAAATCTCCATTCACTAGAGACTGAATGAAATCATTATGTGACCATGGGCAG
SQ  TTACTAAATTTCTTTGAGATTTAGTTTCCTCTCCTGTAAAATGGCAATAATGTACTTGTG
SQ  CCTACCTGAGGGGTGCwTGTGGAGAAGATTAAATCCGATTATCTATGTGGGATCTCAGCA
SQ  CAGTGCCTATTTCATTAGAATTTCTCAGTAAACAGCAACTGCTAATGGCAGTAATAGCCA
SQ  CTATAACCCAAGTTCCCGAGTTTTGGTACAAAGACAAAAACCTAACCAGTCAGTCCATGC
SQ  TGACCAGGTGCCCAAAGAGCTCCTAGAAAAGCTTGATTTTTTCCCGGTGTAAGCCCTGGG
SQ  AAAAATTAATGCCCTCTCTATCCCACCTAAACTTCCCTTTCTCCTATGTTTCCTGGCTTT
SQ  TTGCTTGGTTTGAAACTGGACTTAAACTGCTGCACCTCTTTCATTTGGCTTTAGGAACTA
SQ  TGTGGCGTCCGCAATGCAGAGCAACAGAAAACTGGACAGGACATTCCTGGAATTCGAGCT
SQ  CGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
SC  [J. Bode, direct submission]
XX
SF  contains repetitive sequences [1]
XX
BP  20-30% [J. Bode, direct submission]
XX
FF  low binding potential [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from murine L-cells
EV  in vivo selection of S/MAR [1]
XX
RN  [1]
RX  MEDLINE; 89000669 PubMed; 2844236
RA  Bode, J., Maass, K.
RT  Chromatin domain surrounding the human interferon-beta gene
RT  as defined by scaffold-attached regions
RL  Biochemistry 27:4706-4711 (1988)
//