S/MARt DB - S/MAR

AC  SM0000007
XX
DT  1.1.1999 00:00:00 (created); ili
DT  16.12.2004 12:36:00 (updated); ili2
XX
NA  AS$MAR1
XX
SY  IFNB1-VIII, 
XX
OS  empty
OC  empty
XX
SZ  166 bp
XX
SQ  GCCATCATGACTTCAGTGTAGAGAAAAATTTCTTATGACTCAAAGTCCTAACCACAAAGA
SQ  AAAGATTGTTAATTAGATTGCATGAATATTAAGACTTATTTTTAAAATTAAAAAACCATT
SQ  AAGAAAAGTCAGGCCATAGAATGACAGAAAATATTTGCAACACCCC
SC  [J. Bode, direct submission]
XX
SF  has base-unpairing properties [J. Bode, direct submission]
XX
BP  90% for the multimer composed of 4 oligomerized 166 bp units [J. Bode, direct submission]
XX
FF  derived from IFNB1-E [1];166 bp unit needs to be
FF  repeated at least 2 times to yield matrix binding [1]
XX
EV  re-binding assay (LIS) [1]
EP  monomer and multimers up to (4 x 166 bp) [1]
XX
RN  [1]
RX  MEDLINE; 91027762 PubMed; 2223779
RA  Mielke, C., Kohwi, Y., Kohwi-Shigematsu, T., Bode, J.
RT  Hierarchical binding of DNA fragments derived from
RT  scaffold-attached regions: correlation of properties in
RT  vitro and function in vivo
RL  Biochemistry 29:7475-7485 (1990)
//