S/MARt DB - S/MAR

AC  SM0000008
XX
DT  1.1.1999 00:00:00 (created); ili
DT  2.8.2004 15:24:00 (updated); ili2
XX
NA  HS$IFNB1-I
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  780 bp
XX
LO  9p22
DE  G000308; interferon-beta 1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; 
XX
SQ  ACATGAGAATCCTTTTAGCATTTCTTGTAAGTAGGTATAGTAGTGCCATCCTACCTCAGC
SQ  TTTTGTTTGTCTTGGAAAGTTGTTATTTTTCCCTCATTTCTGAAGGTCAACTTTGTTGGG
SQ  TAAAGTAATCTTGGTTGGCAAAAGAAACTTTTAAATATATTAAACTAAATGAAAATAACA
SQ  CAACTTAACAAAATATGTGGAATCCAGTGAAAGCAGTGCCTATAGGGAAATTTATAGCAC
SQ  TGAGTGCTATATTAGAAAAAAAGAAAGTCATAAAAATTAATCACCTAAGCTTCTGCTTTA
SQ  GGAAAGTAGAAAAATAAGAGCAAATTAAATCCAAGGTAAGTAAAAAAAAAAAAAAAAAAA
SQ  AAAAGAAATAAAAATTAGAGCAGAAATCAATAAAATTGAAGACAGTAAATCAATAAAGAA
SQ  AATCAACATAAAAAGTCTGGTTCTTGAAAAGATATATAAAATTGATAAGCATCTACCTAG
SQ  GATAATTAAGGAAAAAAGACAGAGGACACAGATTACTAATATCAAACATAAAAGCGGGAA
SQ  CATCACTGCAAATTTTATAGGCATTGAAAGCGTAATAAAAGAATACTATAAACTATTCTA
SQ  TAACTACAAATTTGATAAGTAAATAGAATGAACCAATTCCTTGAAAGACATAATCTGAAA
SQ  AATGTAAAAAGAAGAAATAAACAATCTGAATAGCCTATATCTATTAAATAAATTGAATCA
SQ  GTAATTAATAACCTCTCAAAACAGGAAGCACAATGCCCAGATGGGTTCACTAGTGAATTC
SC  [J. Bode, direct submission]
XX
SF  fragment of the S/MAR 5' to IFNB1 SM0000534 [1];
SF  contains repetitive sequences [1]
XX
BP  65-80% [J. Bode, direct submission]
XX
FF  strong [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from murine L-cells
EV  in vivo selection of S/MAR [1]
XX
BF  SB000059; p66 [2]
MM  southwestern blotting; 
SO  pea seedlings; pea
QA  6
BF  SB000060; p62 [2]
MM  southwestern blotting; 
SO  pea seedlings; pea
QA  6
XX
DR  EMBL: AL390882; AL390882
XX
RN  [1]
RX  MEDLINE; 89000669 PubMed; 2844236
RA  Bode, J., Maass, K.
RT  Chromatin domain surrounding the human interferon-beta gene
RT  as defined by scaffold-attached regions
RL  Biochemistry 27:4706-4711 (1988)
RN  [2]
RX  MEDLINE; 95381680 PubMed; 7653165
RA  Rzepecki, R., Markiewicz, E., Adamiec, R., Szopa, J.
RT  Interaction of the Pisum sativum nuclear matrix proteins
RT  with SAR DNA
RL  Acta Biochim. Pol. 42:75-82 (1995)
//