S/MARt DB - S/MAR

AC  SM0000009
XX
DT  1.1.1999 00:00:00 (created); ili
DT  2.8.2004 15:23:00 (updated); ili2
XX
NA  HS$IFNB1-H
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1273 bp
XX
LO  9p22
DE  G000308; interferon-beta 1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; 
XX
SQ  TAATCGTTTATCTATAAATTCTTTTGTATTTTGAATGTAAACAATTAGATCATCTGCATA
SQ  TAATTTTTAAAATCTGATAAGTCAACAAGAGATTGAAACAGGCTCTTCACAAAGAAAATA
SQ  TCCAAATGGTCAATAAACATATGAAAAGATGCTGAAACTTGTTAATAATCAGAGAGATGC
SQ  AAATTAAACTATAATGAAGTATTATTGTACAACAATAGAATGACTGAAATTAAAAAGACT
SQ  GACAATATCAAAGTTGGCAAGAGTCTGATACAACTGGAACTTCTCAAACACTGTTAGTAA
SQ  GAATGTAAATTGGTACAAACATTTGGGAAGTCATTACAATATTATCTGCTAAATCTGAAC
SQ  ATATACATATTCTATGAGCCAGTTACTTCATTCTAGGCATATACCCAAAAGAAGTATGTA
SQ  CTATTGTGCAGTAAAAAATACAGACAAGGAATTTCATAGGAGCATTAATTATCATGGCAA
SQ  ATATTTTAAAAAATTATTAGTAGTAGAAGGGATAAAACATTGTGGTATACTTCTAAATAG
SQ  GGTAAAACACATTAATGTAAATTAATAAACTATACACACAAGATAGACGAATTTCGCAGA
SQ  CATTCTGTTGAGGGTAAGAAACCATTTATACAAAGCTCAAAAACAGACAGAATCTAGAGT
SQ  GTTAAAAGACTGCATGGTAGTGACTTTGGGAGAAGAAAGTAGTGACGAGAGAGAGGAGAG
SQ  AGAATAATGATTGCGAGGTGCTATAGTCTGAAGGTTTGTGTCCCCCAAATTTCACATGTT
SQ  AAAACCTAATCCCCAATGCAATCATTTTAAGAAGTGGGTCCTTTAGTGGATAATTAGGTA
SQ  ATGGAACAAGAGCCCTAACAAATGGGATTGGTGCCTTATAAAAGAAGCCTGAGCCTGAGG
SQ  GACCTTGTTTCCCGCTTCTACCATATGAGAATGCAATGAGAAGGCACAAAGCAAAGAGCA
SQ  AGCCCTCATCAGACACTGAATCTGCTAGGGCCTTAGTCTTGGCTTTTCCAACCTCCAGAA
SQ  CTATAAAAAGAAATGCTTGTTGTTTAAAAGGCATTCAGTCTATGGTGTTTTGTTAGAGCA
SQ  GCCCCAAGAGACTTAAGAGGGAACAAGAGGGCGATTTCTGTTGTGTTGATAATGTTTAGT
SQ  TTGTGGTTACAAAAGAGTGCAGACGTTTTTATTTTATAACAATTCATTGAGCTATATACT
SQ  TAAGATGTATGCGTAATTTTCTATGTATATTATTGTTTTATAAACTTTTTCTTAAAAGAG
SQ  GAAATGGGAATTC
SC  [J. Bode, direct submission]
XX
SF  fragment of the S/MAR 5' to IFNB1 SM0000534 [1];
SF  contains repetitive sequences [1]
XX
BP  75-80% [J. Bode, direct submission]
XX
FF  strong [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from murine L-cells
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: AL390882; AL390882
XX
RN  [1]
RX  MEDLINE; 89000669 PubMed; 2844236
RA  Bode, J., Maass, K.
RT  Chromatin domain surrounding the human interferon-beta gene
RT  as defined by scaffold-attached regions
RL  Biochemistry 27:4706-4711 (1988)
//