S/MARt DB - S/MAR

AC  SM0000012
XX
DT  1.1.1999 00:00:00 (created); ili
DT  26.2.2002 17:05:00 (updated); ili
XX
NA  HS$IFNA10-IFNA7(2)
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  400 bp
XX
LO  9p22
DE  G000306; leukocyte interferon gene J
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G000306;
leukocyte interferon gene J

XX
SQ  ATGCATCATCTCACACTTTCATGAGTTCTTCCATTTCAAAGACTCACTTCTATAACCACC
SQ  ACAAGTTGAATCAAAATTTCCAAATGTTTTCAGGAGTGTTAAGAAGCATCGTGTTTACCT
SQ  GTGCAGGCACTAGTCCTTTACAGATGACCATTCTGATGTCTCCTTTCATCTATTTATTTA
SQ  AATATTTATTTATTTAACTATTTTTATTATTTAAATTATTTTTTATGTAATATCATATGT
SQ  ACCTTTACATTGTGGTTAATGTAACAAATATGTTCTTCATATTTAGCCAATATATTAATT
SQ  TCCTTTTTCATTAAATTTTTACTATACAAAATTTCTTGTGTTTGTTTATTTTTTAAGATT
SQ  AAATGCCAAGCCTGACTGTATAACCTGACTTAAAAATAGA
SC  [J. Bode, direct submission]; EMBL #V00531; nt 7801-8200
XX
BP  75% [J. Bode, direct submission]
XX
EV  in vitro selection of S/MAR 
EC  [J. Bode, direct submission]
XX
DR  EMBL: V00531; HSIFD1
XX
RN  [1]
RX  MEDLINE; 98062364 PubMed; 9398526
RA  Benham, C., Kohwi-Shigematsu, T., Bode, J.
RT  Stress-induced duplex DNA destabilization in
RT  scaffold/matrix attachment regions
RL  J. Mol. Biol. 274:181-196 (1997)
RN  [2]
RX  MEDLINE; 98140121 PubMed; 9479494
RA  Strissel, P. L., Dann, H. A., Pomykala, H. M., Diaz, M. O.,
RA  Rowley, J. D., Olopade, O. I.
RT  Scaffold-associated regions in the human type I interferon
RT  gene cluster on the short arm of chromosome 9
RL  Genomics 47:217-229 (1998)
//