S/MARt DB - S/MAR

AC  SM0000019
XX
DT  1.1.1999 00:00:00 (created); ili
DT  6.3.2001 11:13:00 (updated); ili
XX
NA  MOUSE$INT26
XX
OS  mouse, Mus spec.
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  443 bp
XX
SQ  TTAAATCATCCAAGATGGCCTTCCCAGTTGAAGATCCTGTTGGTACCCTGCTTGCTGAGC
SQ  ATGTACCCACCCAAGAGTTCCTCTCCCCAGCATGTGGTCACGTCCATAAACCCTAGCACT
SQ  CCAGTAGAGGCAGGAGGATTAGAAACTGTCATCCACAGGGAACTGGAGAGATGGCTCAGT
SQ  AGTTAAGAGCACTGGCTGCTTTTCCAGAGGACCTGAGTTCACTTCCCAGCACCCACAGGG
SQ  CAGCTCACAGTTCCAGGGGACCCAACACCCTCAGAAACATAAAAGCAGGCAAAACATGAA
SQ  ATAAAAATAAAATAAAATAAAAAGTCATCCTCAATTTCTCAGCTAGTCCATGCCAATCTG
SQ  GAAAACATTAGACACGCCCGTCCCCTCCCCCCCACTCCCCCAAAAAAGAAAAGAAAATAT
SQ  CATCAATATTTTTCCCAGAATTC
SC  [J. Bode, direct submission]
XX
FT  264 - 265: single strand cut by retroviral integrase [J.
FT               Bode, direct submission]
FT  268 - 269: single strand cut by retroviral integrase [J.
FT               Bode, direct submission]
XX
SF  direct & inverted repeats >8 bp [1]
XX
FF  retroviral integration site [1]
XX
EV  in vitro selection of S/MAR [1]
XX
RN  [1]
RX  MEDLINE; 96194144 PubMed; 8652565
RA  Mielke, C., Maass, K., Tuemmler, M., Bode, J.
RT  Anatomy of highly expressing chromosomal sites targeted by
RT  retroviral vectors
RL  Biochemistry 35:2239-2252 (1996)
//