S/MARt DB - S/MAR

AC  SM0000026
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$MAR19.2
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  420 bp
XX
SQ  GGGAAAGCTTGCATGCCTGCAGACCCGAGACTGCCTAGGTCACAACGCCTCCAGCAGGCC
SQ  CAGAGTCTCCTGCCCTGGCCACAGGCAGCTCCCAATTAGCCCAGATGCATCCTGGAGCAC
SQ  AGGGCCTTAAAGGCTCCATTCACCCACGCATGCATTCCTTTCCCTCCACCAACGGAGTGA
SQ  GGGAATTCACCCTACTCCACACCAGAGATGTGGCCGGAATGCAGAGATGAAGTCACTGAG
SQ  CACAGTAGGTATGGTCTTACCCTTGAGAAGCTAGTGGGAAAGAGAGAGTTTGATTGGCAA
SQ  AGCACTTATCTATTGGGTTCCAGGCAGGAACAAAGGCAGCACTCTGCAGCAACCCCTGGT
SQ  GGATTTGGATTGCCCAGGGTGGTCAAGTCTGGCTTAGCAGTTGACAACAGACTCATGAGA
SC  EMBL #S67076
XX
FT  1 - 7(EMBL): "purine box" [1]
FT  92 - 101(EMBL): D.melanogaster engrailed binding site [1]
FT  129 - 133(EMBL): "purine box" [1]
FT  179 - 185(EMBL): "purine box" [1]
FT  204 - 208(EMBL): "purine box" [1]
FT  223 - 227(EMBL): "purine box" [1]
FT  265 - 270(EMBL): "purine box" [1]
FT  276 - 288(EMBL): "purine box" [1]
FT  326 - 330(EMBL): "purine box" [1]
FT  332 - 337(EMBL): "purine box" [1]
FT  436 - 440(EMBL): "purine box" [1]
FT  461 - 467(EMBL): "purine box" [1]
FT  492 - 496(EMBL): "purine box" [1]
XX
SF  TG-rich regions [1]; perfect and imperfect repeats [1]
XX
FF  fragment [1]
XX
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: S67076; S67067
XX
RN  [1]
RX  MEDLINE; 94043516 PubMed; 8227178
RA  Boulikas, T., Kong, C. F.
RT  Multitude of inverted repeats characterizes a class of
RT  anchorage site of chromatin loops to the nuclear matrix
RL  J. Cell. Biochem. 53:1-12 (1993)
//