S/MARt DB - S/MAR

AC  SM0000028
XX
DT  1.1.1999 00:00:00 (created); ili
DT  9.3.2001 17:41:00 (updated); ili
XX
NA  MOUSE$IGF2-MAR2
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1915 bp
XX
LO  7
DE  G001245; insulin-like growth factor 2
DP  Direction: 5'; Pos 1: ATG
DN  Gene position numeral: 1
DC  near P1 promoter of Igf2
DE  G001246; insulin II
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G001246;
insulin II
G001245;
insulin-like growth factor 2

XX
SQ  AATTCTGCCTCTGCTGACTCCTCACAATTAGAATATTTTGGCTTGGGCCCCCAAGTTTGC
SQ  TTCTGGCTCCTAACCATTTTAAATGCAAGCTCCTATATATAGATATAAAACCACCATTCT
SQ  CAGTTCCCTAAAATTTAAAGTAAGCCTGGGTCCTTAGTCCTTTTGACAAAATTTCCTTAC
SQ  TTGGGAGAGCGGACATTTTGACAGCATTTAGGCACTGTCTCCAGGGGATGAGGTAGCGGG
SQ  GTGTTTTCCCCATGTTCCTATCATTTTATATCTGCAGTAATGTTCCTGCTGACTCTCTTC
SQ  CCCCGCCACCCGTCCCTCTGGTTTTATTAACGTGGAACACTAGATTCTGTAGTCTATTGC
SQ  CCTAACTCCAAATTTTACAAGTTGAATCCCACCCAGACAGCTTTAACAATTTTCCTGGCA
SQ  CCTTCAAAGTCCCAACCTTTTTTTCTATGTCCTCCCCTAAATGTAGACACCTCAAATAGC
SQ  CCTCACTCTCATTTCTCGGATTCCAGAAAATGGAAAGAGTACATTCACCAATCACATCTA
SQ  AAATTCACTTAACAAGACCCCCCCCCAAAAAATTCCACNAATACACACTGGTCACAAGGG
SQ  CTTTGGGGCTCCCTAAAGCTCCTGCAAGCATTCTGGCCATGGTTAGGGTTCTTTAAAATA
SQ  TAAAATATAAACTCTCTCACTAAAGCCCCCAAAGCAGGGCTGAGCCAATGATGTAAGGCA
SQ  TGAACTTCTATGTGGCAGAGGGCTTTCCATGCTATCCCAAGTCTTATATGACTGTTCCAT
SQ  GTCTTTCTGGGTCACAGATGGCACAAAATTAACTCTTGGCCAAGTCCTTTTTCTTTATAT
SQ  TAGAATGTTGAATGTCTCCAATCCTTGAACACTGATCATTTTTTTCTGCATCAAATCTGG
SQ  GTCCCTTTAACTTAACAATTTGGAAAAAAAAATTTTTTTTAACTCAGACACCAATTGCAA
SQ  AATCCAGTACCATCCTGTATCCTTTTCATCCCCCGTGTTGGCTCATGCCTGGTGTCCTCA
SQ  AACATTAGGCAATATTTTCCAGGCCCCCCAAAACACACTTAGTGTTAGCCTTGGGTCACA
SQ  AAAAGGTTCTGATTTCTCCCACTGCAATACCAGCTATACACCCACTCAGCCCCCCTACAT
SQ  TTCAAACACACCCCCCCCCACACACACACACACACTATCTTGCACAATCTCTGCAGATTG
SQ  CAAATTTGGGGGATTGGTTCTCAGGCCCCATAATTTAGGAACCCATAATCTCTATTCCTG
SQ  TAATGTAGAGACTGGCCCTAAGGACCTAGGAAACTTTAGATTCAGAAATTATCTTCCTGG
SQ  GCCCCCCCAAATTCAGGTACTCCAAAACAAATTGAGATTTTTTTCTTCCAAAGAGTTCGG
SQ  CCCCCATTAAACTTTAATGAACTTTGTTGAATTTATGACTTCTACTGGAGTCTCCCTATA
SQ  TTTGGATAATGTTTTATGGTCCCCAAAGCACACTGAAAAAAAAAGTCCCAGATCCCCCAA
SQ  TTCCTAGGTTTTAAGGTCTGTGTCTTACAAATTTCCTAGCTACTAATTCTATTCCCTGCA
SQ  ATTTAGATTTCATCATCCATTGGGTAATTTTTATTGATCCACAAACAGGGAGTATGTTTC
SQ  TCCAAGAACAAACATTGTCCAAGAAAAACATACAAACTCCCCCTTGTTCAACAAAAAGAT
SQ  CAATAGGAATCTGTTTAGGAAATTAAAATATTAAAAGACATTGATTTTTTCTGGCTTTCT
SQ  CAAATGGACTTCTTGCATTTCTAATTCCACCACATTTAGACAGCATTTCCTCATTCTCTA
SQ  GAGGACTTCTCTGAAGCCACAGAAATTAGAGGTGATTTTTCCCGGGTGTTGTAGGGCCCA
SQ  CTGGCTTCAGGGTGAACCCTAGTCTCCACTCCCACCCCTCAAAAGAACTGACCTG
SC  EMBL #U71191
XX
FF  stronger binding affinity when compared to IGF2-MAR1 [1];
FF  coincdes with a developmentally regulated DNase
FF  hypersensitive site [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from mouse hepatocytes
XX
DR  EMBL: U71191; U71191
XX
RN  [1]
RX  MEDLINE; 98051897 PubMed; 9337391
RA  Greally, J. M., Guinness, M. E., McGrath, J., Zemel, S.
RT  Matrix-attachment regions in the mouse chromosome 7F
RT  imprinted domain
RL  Mamm. Genome 8:805-810 (1997)
//