S/MARt DB - S/MAR

AC  SM0000029
XX
DT  1.1.1999 00:00:00 (created); ili
DT  9.3.2001 17:54:00 (updated); ili
XX
NA  MOUSE$IGF2-MAR3
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  2139 bp
XX
LO  7
DE  G001245; insulin-like growth factor 2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G001400; 
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DE  G001401; ribosomal protein L23
DP  Pos 1: ATG
DN  Internal: n; Gene position numeral: 2

G001245;
insulin-like growth factor 2
G001400;
G001401;
ribosomal protein L23

XX
SQ  AATTCATTCTGGTCCTCAAGATGATCATAGGAAACAGAACACAATACATCTTTATAAACC
SQ  TGATGGACAGCCAGGCTGAGAAGATAGCCAGGCTCACACTTTACAAAGCCTTGTCCTGTC
SQ  CTCTCCCAAGGTCCTCTTTGGACCTTTCCCAGGTTCAAAGAGGACCTATGGCCCTCCTGT
SQ  TGGATCTGGAGGGCCACTCATTCTGGAATTGGGCCCTCAGATCTGCACTTTGGGTCCCTG
SQ  CATTCCACAAAAGCATATTGTTTCTATTCTGTCAATGACATTATCTTGCTAGGGCAGTTT
SQ  TGAATCTCAAATTGATCTTCCAGCCCTTGGCTTATATCTTCCAGAACTGATCTTTCAATG
SQ  TCTAGACTGGTACATGCTGAAGAGCATGAACTCAATGTGGGTTGCATAAATGGGGTGGGG
SQ  TGGGATATAGGGATGTATGAATGTATGGATGAATAGATACAAGAATGTGTGGGTGGTGAG
SQ  TAAATAGAAGGATAGATGGGTGGACACAGGCATGATCATGCAGATAGATTGATGGATGAA
SQ  AAGATGCAAGGATGGAGTGAATAGAGTTGGGTGAGTGGATATATGTATAGGTGAGTAGAT
SQ  GGATTAACTGATGGATAGGCTTATAAATAGATGAAAGGATAGATAAATGGATGGATGGAT
SQ  ATATGCATCAATATATGGGTGACTGGCAGATGGATAGATGCATGAATGTGTGACTAGACT
SQ  GATGGTTTGATGGGTGAGTGGGTGAATAGATAGACACATACATGATGTGTAAGTGGTTAG
SQ  ATGGATGGATAGAAGATAGGTTGAAGATGGATAGATATGCGAATTGTGAAAGGTTGGATG
SQ  GATGGTAGATAAACTCATGAATGTGTGAATGTTTTGACAGGTTTAGAAAGGCAAATGGAT
SQ  AGATGTGTGAGTATATGAGCGTATGAAAGGATAGCTGGAGAGAAAAATGACTGGGAAGGT
SQ  TCATGGGTGTGTCAGCTGTACACCCATAAGCATCTACCTGAGTTCTCATCTGAGATGGTC
SQ  TTGGTGTAGAATGAATGACAAGAGTAAAGACACTGTAATTTATGGAAGTACCCGTTTCCA
SQ  TAGTGTGTGTGCTCATTCTGGTTGTACTATATCCTCCTTCTATAGTCTGTCCAAGAGTAG
SQ  GAGTTGTGATATGTTTATTACTTATGTCTTATTATTTTTTATTTATTATAATACTGTATA
SQ  CTATATATTATATGATGTATGTCACATATAATATATAATGCATGATATATAATAGATCAT
SQ  ATATCTTAGAATAATATAATATACAATAATATAACATACATAATCATTATATAACATATT
SQ  AATCATAAATACAATATATAATATAATAATTTATTATTGTTTATACCTTGTTATTTGTTT
SQ  ATTATATCTTATATCTAATTATTAATTAAAACATAAGGTTAGTATCTAGCTTTTTCTGGA
SQ  GGGCCTAGAAAAATCTAAAAATGTCAACAACTAGACTTCTACCTGAAAGTTATAAACTCT
SQ  CTCAGAGAAAGTGTCATAGTTTTATGGGCAGGTTTCTAAACTCTAAAATTATCACTATGA
SQ  CTTATAAAGCACAGAAGATGTTTATCATAAAACCCTGACACCAAACCCAATCATGGTAGC
SQ  ACAAAAAAGGAAAACCCACAGTTTCAAGTCACATGTGAAGAAAGATACAAAAGTTACCCA
SQ  TCAAGGAATTAGCAAACTGAGTCTGGCAGTAGGTTGAGTTAAAGTAATAACATGATATGG
SQ  CCAAGGATCATCAGCTTCCAGGAAGGCAAGGGTGACTCATTAGTGAAAAATCCACTTAAT
SQ  ATCATCATGTAAATAGGCCAAGGGAAGACAAAATGTATAAAATAGAGATGTCCCAGAAAT
SQ  ATATTTAATAAAATCCAAAATGTATTTCCAGTATTCCCAGTTAATAATACATGCATAAAT
SQ  GGCTAGGGCTCACCTCACTCTGGTGGTACACAACTTCAGTTCCAGCACTCAGGAAGCAGA
SQ  GGCAGGAAGATCTTTGTTCCTGAGTCTCCTGGCAGCCCATCACCCACCACCCGTGTCTCT
SQ  GTCACTCTTCTGTCACTGTGATAAAACACCATGATCAAAAGCAACTGACAGAAGAAAGTT
SQ  TATTTTGGCTTATGGCTCCAGAGGGTACGAGTCCATCAC
SC  EMBL #U71192
XX
FT  1023 - 1943: matrix-attachment region motif cluster [1]
FT  1295 - 1335: motif for SATB1 [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from mouse hepatocytes
XX
DR  EMBL: U71192; U71192
XX
RN  [1]
RX  MEDLINE; 98051897 PubMed; 9337391
RA  Greally, J. M., Guinness, M. E., McGrath, J., Zemel, S.
RT  Matrix-attachment regions in the mouse chromosome 7F
RT  imprinted domain
RL  Mamm. Genome 8:805-810 (1997)
//