S/MARt DB - S/MAR

AC  SM0000030
XX
DT  1.1.1999 00:00:00 (created); ili
DT  9.3.2001 17:57:00 (updated); ili
XX
NA  MOUSE$Rpl23-MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  2348 bp
XX
LO  7
DE  G001400; 
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -2
DE  G001401; ribosomal protein L23
DN  Internal: n; Gene position numeral: -1
DC  rpl23 identified by sequence homology to the second exon of
DC  human rpl23 [1]

G001400;
G001401;
ribosomal protein L23

XX
SQ  AATTCTCTCAGGGAAGAGAGCTGGGCAGTGAGAGGCCCCCTAGACGTTTCCGTTGCGCAG
SQ  GGGTCATTGTCTTTGCCAGCTGATGTGCGGCGCCCTAGACACCGTTGTTCCATGGCTTTG
SQ  TGTCTGTTTTGTTTTGTTCTGTTCTGTTGTTGGCTGCTGCAGGCAGGCGGGTAAATCCGG
SQ  TCTCTATTACTCCATTTTAGCCAGGAGTGGAAATATGCCTTTTCATTTTGGTAGACAATG
SQ  TTTTGATATACAGAAAATGTAAAGTTTCCCAGCATGTGGGCAGTGGAGGCAGGAGATTAG
SQ  AAGTTCAGAATCATGTTGAGCAACACAGTGAGTTTAAGGCCAGCCTGGGCTACACAGTGA
SQ  GTTCAAGGCCAGCCTGGAATACATGAGACCCTATTTCAAAAACATAAATTAACTTTCAAG
SQ  AGGAGGAATCTACTARCCTATTTATCTTCCACAATTCTGTTTGCCGGTGTTGTTTTGTTC
SQ  TGTTTTTTTAAGCTGGAAAAATGTTTCTCAGCATGAAAACAGATAAAAACAGATTTTTTT
SQ  CCCCTGTACTTCCGAATTATCAATTTAATTTTAAATGCTATTTTATTTATTCTTTGAACA
SQ  TTTCATATGTGCATCCAATGTCTCTCGACCACACCCACCCTGATTTTATTCTTAACAATT
SQ  TTCTTCTGCTGAACTTTCTAACTCCCTCCCTGCCCTAGGAATGGAATGGGAACAAAAATC
SQ  CCAGTCTCCCTTTTTCCTTCCCAGTTCATATTTTATTTTCTCATCCTTTTCTGTTAAACA
SQ  TACCCCCTTCTCCACGGGGCTGTGCACCCCTGCAAATTCTCTTGTGTTCACTGTTTAATG
SQ  CTGATAAACACTGTGCGAAAGGGATGAATGCTACAGTCAGGAGAGCAGAGGGCACAGAAG
SQ  GCATGGCCAGCGTGTCCCTGCTGAGCTTGTCACTTGGTAGCCGGGTGGTCTGGGGGCTCT
SQ  GTGGAGACTGGCTTGAACATCTTTGTGCTGTTCTTGGGCCCCAAATGATGGTAGGGTCCA
SQ  CTTCCTTGGCTACGAGGGTCACAGGAGACAAAAACCAAGGATGCTTTGTGCAGTCTCAGT
SQ  AGGTAGGGAACATACCTTATGAAACTGGACTCTGCTTCCTTCGCTACAGCTTCCTGTTTT
SQ  TGTCGGTATTGAATTTTAGAATTGTCACTCCACCGAAGGCTGTCTTACCCCTGGCTTTTA
SQ  TCCTCAAGAACCAACCCCCTATTACAATGTTGGTTGATTCTAAACACTGGAGCCCCAACC
SQ  TGTCATCCCAGCAGGTTAGTTCTGGCTAAATAATGAGTCCAAGGCCAGCTAAGACTGCAG
SQ  GAGACCCTGTCCCAACAAAGAGGCAATCAAATAGAAAATATTTTTGTTTAAAAAACTCTG
SQ  GTAAACTATACAGTATGCACTAATTTGGGCGGTGGGGGGGGGGGGAGGTTTCTTAAGAGT
SQ  CAAGCTTTGTGTGCAAAAAGCATAATCTCTTTTTCTGTTTTTATCTTTTCAAGTTTCATT
SQ  TTAACATGTTTTAGTTGTTTGAAATTTTCTTTCTGGAGACCAGGACAGTTCTCAAGAGGA
SQ  TCATGTCTAAAGACTTTTATGTCTTTGATTGCGGCTGTTGTTTTTATGATATTTTTTTAA
SQ  TGGAATTTTTTTCACTTTTCTGTATCTCCTGGCTGGTTGCTGGTGGAAAATAATAAAATA
SQ  TATTGATTTACAATACACATTTTGCATCTGACTGCTCCCTGAACCTCTCATTCATCCTGA
SQ  GAACTCTTCCGCTGGCTCTCTGGGGGCCGCAAGAATGTGGTATTTTGGTCTCCTCCTTTC
SQ  CAGAAGTTATACATCTTATTTCCGTTGAACATCTTTTCGCATTGTCTTGGGTTTTCAGAC
SQ  CCCGGTAAAGCAGTAATGGCAAAAGCAGGCATCCNGTGCGTGGTTCCTGCCTGAGCTGGG
SQ  GCTCGGGCTTCGCTGGGCTGGACAGACAAAGATAGGGCTTATTTATAGCTTTCCCCTGGT
SQ  TACTGCAGTGTTTGTTCTGTTTTGCTTGTGAATGTAAAGATAGGGCTTTTTGCGATGTCC
SQ  TTCCCTCCATAGAAATTAGAGTTTTTGCGATGTCCTTCCCTCCATAAAAATTAGAATTTT
SQ  TATGATGTCCTTCCCTCCATAAAAATTAGAGTTTTTATGATGTCCTTCCCTCTATAGAAA
SQ  GTTAGCTATTGAACTGTTTAATTGTTGAGATGTACAGAAGGCATAATTAAAGCAGGAAAA
SQ  ACCTCCACCCGCCTGTCCAGTGCTGGCGCAAGGCAAGGAACGTGAGGAATGCACCCTTAG
SQ  GCTCTGTGTGGCCCCTTGGCCCTCACGTCCCCTCCTCTGCCGGGCTCCAGGGACCCTTCA
SQ  TCTGAATT
SC  EMBL #U71193
XX
FT  125 - 2209: matrix-attachment region motif cluster [1]
FT  2030 - 2160: 4X repeat of incomplete interrepeat homology
FT                 [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from mouse hepatocytes
XX
DR  EMBL: U71193; U71193
XX
RN  [1]
RX  MEDLINE; 98051897 PubMed; 9337391
RA  Greally, J. M., Guinness, M. E., McGrath, J., Zemel, S.
RT  Matrix-attachment regions in the mouse chromosome 7F
RT  imprinted domain
RL  Mamm. Genome 8:805-810 (1997)
//