S/MARt DB - S/MAR

AC  SM0000032
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 10:08:00 (updated); ili
XX
NA  MAIZE$adh-3MAR2
XX
SY  ZM29136, 
XX
OS  maize, Zea mays
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1195 bp
XX
LO  1
DE  G001247; alcohol dehydrogenase 1, 1F allele
DP  Direction: 3'
DN  Internal: n; 
DC  about 8 kb downstream [1]
XX
SQ  TCTAGAAGTTAAAAGAAATGGAATACTTTCTTGTGAACTTTCTACTTGTAATGAAACCAT
SQ  TTCTTATTTAAAAGGTGAAATTAATGTTTTAACTGCTAAACTAGAAGTAGCAAGTAACTC
SQ  TTGTGTTGAAAATATTACAATTTGCACTAGGTGTAAGGATTTTGATGTTAATGCTTGTAG
SQ  TGAACACTTAGTTTCAATTTCAAAACTAAATGATGAAGTGGCTAGTCTTAATGCTTAACT
SQ  TAAGACTAGCAAAAGTGATTTTGAAAAACTAAAATTTGCTAGGGATGCCTACACGGTTGG
SQ  TAGACACCCCTCAATTAAGGATGGGCTTGGCTTCAAGAGGGAAGCCAAGAACTTAACAAG
SQ  CCATAAGGCTCCCATTCCCGCCAAGGAGAAAGGGAAGGCCCCTATGGCTAGTAGTGCAAA
SQ  AAGGAACCATGCCTTTATGTATCATGATAGGAGACATGCTAGAAATGCTTGTAATGATTT
SQ  TGATTCATATGTTTATGATTCTCATGCCATGTTTGCTCCTAGTCCTTCATATGTGTATGA
SQ  TAGAAATGTTACTAGGAGAAATGTTGTTCCTAAAAAGAATGTTATTCATGCTCCTAGGAA
SQ  AGTAGCAAATGAACCTTCTACCATTTATTATACTTGCAATGCTCCCTTTGCTATTTGTAG
SQ  AAAGGACAAGAAGGTAATTGCTAGGAAGTTAGGGGCAAGATGCAAGGGAGATAAAACTTG
SQ  CATTTGGGTCCCTAAGAATATATGTGCTAACCTTGTAGGACCCAACATGAGTTGGGTACC
SQ  TAAGACCCAAGCCTAAATTTGCCTTGCAGGTTTATGCATCCGGGGGTTCAAGCTGGATTA
SQ  TCGACAGCGGATGCACAAACCATATGACGGGGGAGAAGAAGATGTTCACCTCCTACGTCA
SQ  AGAATAAAGATTCCCAAGATTCAATTATATTCGGTGATGGGAATCAAGGCAAGGTAAAAG
SQ  GTTTAGGTAAAATTGCAATTTCAAATGAGCACTCTATTTCTAATGTGTTTTTAGTAGAGT
SQ  CTCTTGGATATAACTTGCTATCTGTTAGTCAATTATGCAATATGGGGTATAACTGTCTAT
SQ  TCACAAATATAGATGTGTCTGTCTTTAGAAGGTGTGATGGTTCACTAGCATTTAAGGGTG
SQ  TATTAGACGGCAAACTTTACTTAGTTGATTTTGCAAAAGAGGAGGCCGGTCTAGA
SC  EMBL #U29136;  release 47
XX
SF  2 putative topoisomerase II sites [1]; 1 unpairing
SF  region [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: U29136; ZM29136
XX
RN  [1]
RX  MEDLINE; 96038641 PubMed; 7580257
RA  Avramova, Z., SanMiguel, P., Georgieva, E., Bennetzen, J. L.
RT  Matrix attachment regions and transcribed sequences within
RT  a long chromosomal continuum containing maize Adh1
RL  Plant Cell 7:1667-1680 (1995)
//