S/MARt DB - S/MAR

AC  SM0000034
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 10:38:00 (updated); ili
XX
NA  HA$MAR2538
XX
OS  hamster (Chinese hamster), Cricetulus griseus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha;
OC  cricetidae; cricetinae; cricetini
XX
SZ  2538 bp
XX
LO  1q
DE  G001501; adenylate deaminase 2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  as juged by the restriction sites present in the (EMBL)
DC  sequence, this sequence is refered to as "B" in [1]
DE  G001502; gluthatione S-transferase M
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  as juged by the restriction sites present in the (EMBL)
DC  sequence, this sequence is refered to as "B" in [1]

G001501;
adenylate deaminase 2
G001502;
gluthatione S-transferase M

XX
SQ  TCTAGATTTATGATGGTAAATCATGGGGCACGGCACAGCAATGAGAATCGACATTTATAT
SQ  ATTACTTTAACAACATGTTAAAGATGTGTTAATTTTAAAAGCAAATTTATACATAATAGA
SQ  ATCTCGATTGAAAAAAAAAAATCACTTGAATTTAGCATTTGGTGGCACACACCTGTGACC
SQ  CCAGTACTAGGAAAGTTGTGTAAAAGGAGCAAGAATTGAAGGCCAGCCTAAGCTGCATAG
SQ  GAGACTGTCTAAAAAACAAAACAAAAATACTACTTTTTAAAAAGTGGGGATGGCAAGATG
SQ  ACTCAGTAAATGATTGCTGGTATGCCTAGCAATCTCAACTCCATCTCTAGGACTCACCAT
SQ  ACACTCCATGACAAGTATACATACACACACACACACACAAATAAATGCAATAAAAAATTT
SQ  TTGAGTCAGATGCAGCCTTGGGAGGCAGAGACAGGCAGATCTCTGAGAGTTTGAGACAAG
SQ  CCTGGTCTACAAAGTGAGTTTCAGGACAGGCTTGGAAAAAAAAATTGAAAAAAGTAACTG
SQ  GAAGGAAAAAATATAAGTATCTAAAAATATGTTCATTCATATATATATATATGTATTTAT
SQ  AATATACATATATATGTACTTATAATATATATATATATATATATATATATATATATATAT
SQ  ATATGTACATTATAAGCAAACTCTTGGTAAAATTGGTAGGCCAGGATAGGATTTGTACTT
SQ  CCTATTTTTCTGTATCCTCAAAGTTTTTTTTTTTCTACTCAGGCATTTTACTTATATGTT
SQ  TTTGTTTTATGCCCCTAGAAAAAGAATCCCAGGGTGAAGCCTCCTGTGTGCTTTCATCTT
SQ  AATTTTTCATGCTTCATGCTGCCACCTTAGTGGCAGTAAAACCAAGGCTCTTAGTGCAGT
SQ  AAAAACAAGCCGGCAGGGTGGTAGTGGATTATTCTGTCCATTTTCCCTAGGTCTCTGAGC
SQ  TGCTCATCACATTTGGGGCTCACCATGCCATACTTGTTCAGCCTGGAAGTGAGGCTCACT
SQ  TTCCCAGCTCTGTGATTAGCAATGACTGCCATCAAGGCCATGCTTCAACCGCAGGTGGGA
SQ  ACCAGGTGAGGTCCCTCGAGTACAGGCTGATAAGGATGGGGTGTGCATCTATCTCCTCAG
SQ  CATCATTTGTACTCCTGGAGCACCAGCCAGGAAATTCATGTGACCCATATGGCATTGCAG
SQ  AAAGTTTCTTTTTTAGCTGGCAAAGACCTTCCCTACCTTTTAAAGATTAGTTGCTCCTGG
SQ  GCTGAGTGTACAGCTCACTAACCTAGTATATGAAAGGGTCATGCATTCAATCCCTGGCAT
SQ  CACAAAATCAAATTTTAAAAAGGGGGAAAGATTCACTCTTGATAAATGTTTGAAAGAGAA
SQ  ATTTCTGCAAAAATTAAAACCAAAGTCCAGTTTATACGAAATTGGCGAGGCTGCTAAGAA
SQ  AGTTAGTGATGCACTGAGAAACGCTGGGCAGGAAGATGAAAGGAAGGATTTGATTTAATG
SQ  ACGATTCAGAGAATGAATATGGAATCCTCAGTGCTGGTATGGGACAGGCAGTGCTGGCCT
SQ  TCAAGGGATGGTCTAGATCTACAAATCCTGCTTGCCTGATTTCCAAAAGTTAGCGCCCAT
SQ  TAGCCTTGACAAGCATTGTGTTTGGGGGAGCACAGACAAGGCCCAGCGGAGACCCTTAGA
SQ  CATGGTACTGTCTCCATTCTGTTGCTGGATATTTCTACCTTCAGAGCCCATTTTTCTTTT
SQ  TCTTTTCTTTTTTTTTCTTGATTTTTCGAGACAGGGTTTCTCTGTGGCTTTGGAGCCTAA
SQ  CCTGGCACTCGCTCTGGAGACCAGACTGGCCTTAAATTCACAGAGATCCGTCTGCCTCTG
SQ  CCTCCCCAGTGCTGGGATTAAAGGCGAGTGCCACCACTGCCCAGTGAGCCCATTTTTCTA
SQ  AGCAGAAATCAGTCTGGGTGTTTGTTTTTCTGTGTGGCTTATTTTGTGTATAGCCTTCTG
SQ  TCTAGCTCTAACTCCAGCATTTAGTTCAGAATGTCTAAAATGGATTGGCTAGGAGCCAGT
SQ  GAGAGTCAGGAGGGGAAGTAGAGCTGCTTTGGATCTCTGGGCGCACCTGCTACAGTCTGA
SQ  GGCCAGATACAGATGGGCCCTCCTACCTGCTCAGAGTCAGGGGTTAGGGAGTGGGGGCCK
SQ  GCCAGTCTCTGTGGGCTCCCAGCCAAGCCCTCCATCACACAGGCTTACCTATTCTGAGGC
SQ  AGGAGGCCCCTAGTGCCTCTCCACCCAACAGCAGCTGTGGCAAGCATCTGCAGCCTACAC
SQ  AGGAAGTACCCTGTGCTGTCCAGGGCCTGTCTGCTTCCCTTCTTTACAGGCACAGCAGGC
SQ  AAAGAGGTGCACTGCAAATTGCACCATAGACTTGGGGTAGAAAGTGAATTGCTAGAGATA
SQ  AACTAAAATACAAGCAGCTCCAGCTCCAGCTCCTTACAACACAATCTAACAGTGATGTCT
SQ  GTCACCATGCCTGCCATCTTTACGTCAGAATCCCCAAGGGAGAGATCTGGAAAGAGTATT
SQ  GTAGACAGGCTATCTAGA
SC  EMBL #X96547
XX
FT  1298 - 2418(EMBL): repeat [1]
FT  1437 - 1462(EMBL): repeat [1]
FT  1875 - 1918(EMBL): A/T stretch [1]
XX
SF  AT-rich sites; Topo II sites [1]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: X96547; CAMAR2538
XX
RN  [1]
RX  MEDLINE; 98044969 PubMed; 9383712
RA  Fernandez, M. A., Baron, B., Prigent, M., Toledo, F.,
RA  Buttin, G., Debatisse, M.
RT  Matrix attachment regions and transcription units in a
RT  polygenic mammalian locus overlapping two isochores
RL  J. Cell. Biochem. 67:541-551 (1997)
//