S/MARt DB - S/MAR

AC  SM0000036
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 10:44:00 (updated); ili
XX
NA  HA$MAR7981
XX
OS  hamster (Chinese hamster), Cricetulus griseus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha;
OC  cricetidae; cricetinae; cricetini
XX
SZ  7891 bp
XX
LO  1q
DE  G001449; GTP-binding protein, alpha i3 subunit
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; 
DC  also mentioned as region D in [1]
XX
SQ  CTCACACATTCACTGACAGTAGCCTCAGCACTAAGTGTCTGAGTAAGATCCCTTAAGTTT
SQ  AATTACTTCAGAGATCAGTGTCCCAATTTTTTTGAGGAAAATGAAGTATAAAAATTAAAT
SQ  TTTAAGCATATGTCCAAAGAGATACAAAACACAAAATTTAAAAAAACTAATATTAGGGGC
SQ  TGGAGAGATGGCTCAGCGGTTAAGAGCACCAACTGCTCTTCCAAAGGTCCTGAGTTCAAT
SQ  TCCCAGTTCCCAGCAACCACATGGTGCTCACAACCATCCGTTATAAGATCTGGTGCCCTC
SQ  TTCTGGTGCGCAGATGTACATGGAAGCAGAATGTTGTATACAAATAAACAAATAAAATCT
SQ  TAAAAAAAAAAAAAAAAACAAAAAAAACCTAATATTAGTCCCAGAAAGAAATTCGAAAAT
SQ  AGCTTTATAATGTAAAATATATATTACCAGAAGTAAGCTGGTATAGTAATTCAGCCCTGA
SQ  TGGAGTCAGTGTATCACAGATACATAACAAGGGTTTCTCCCTACACAGTCAGTGTGTTTT
SQ  TTCTCTAGGAGCAATAACAGTTATGTGGGTTATTAAAAGGATGATGTGGAATAAAAGCGT
SQ  ATTGAGAAGGGGAATTGCATGTAAGTAGTAAGGAGGCTGACAAGTGGCCTGGCTTGTTCT
SQ  GAATATGGCAGCAGTGGAATTTACAGTGGTGGAAGGGATGAGGAACTTGTGAAGAGTTTC
SQ  CTCGGGTACACACTGTAGGAGCAGCGTGTAGCAGGAGTGCAGTGAAGATAGTAAGGTGGT
SQ  TAGTAAGGGCTGTCTTAGGTACAAAGAAAACCTTTTGCTGAGAGCTGGGAGGTACATCTT
SQ  AGAAGCCAGGGGCAAAGATGCAGGTGGGTCTAAGAATGAAATTCAGCTGGGTGGTGGTGG
SQ  CCACGCGTTTAATCCCAGCACTTGGGAGGCAGAGACAGGCACATCTCTGTGAGTTCAAGG
SQ  CCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCTCCCAAAGCTACAGAGAAACCCTGTC
SQ  CCGAAAAACCAAGATAAATAAATAAACAAGCAGGTGGGAAAATAGAATTAAAATTCAAGT
SQ  TAGCATAAAGGGATAAGCCAATTGTGGTATATATCTAGAGTTTTAACTTAGTCATAAAAA
SQ  GAACTAAATACTAGTAGGTGCTGTATCTTAGATAAACCTCAGAAACACTATACTAAGTAA
SQ  AAGAATCCAAACATAAAAGTTATATAATGTTTGGGTCCTTTTATATACTATATCTAAAAT
SQ  AGGCAATCCTTAGAAAAAAGAAGCATATTTTGTGTTTGGGGGGGGCATGTTACTTAATGA
SQ  TTACAAGAGTATTTTTCTCAAATGATGATATTTTGAAACTAAGATGGTAGTAGTTGTATA
SQ  ATGAATGTCATGAATATACTAAATGTTCTAGAGTAACATACTTAAAAATGGTTAAATATA
SQ  TATTTGGTGAAATTTCCTTATAATTATGGGGGGCACTGATTGCTCAATGGTAAAGATCAC
SQ  TTTTTACAGAGGATGCAGACTTGGTTCCTAGTACCCATATGGTGAGCTATAATCACCTGT
SQ  AACTCAAGTTGTAGGGGATCCAGTGCCCTCTTCTGGTTTCTGTAGGTACCTACACATGAA
SQ  ATTAAAGAAAAAAAAAAAACTTTACCATTTAAAAAAAAAAAAAAACTTTTACAATTTTAC
SQ  AAATGTTTATATGGGGGCATTGTTTCCCTCCTCCTGGCCCCATTTCTGAGGGTGCGAGCA
SQ  CTGGGCTCACCATTAGAGCCTTTGGTTTCCTTTTCAGCATAGAAAGTACCTCTTAGACCA
SQ  GAGAAGAGATACTGGAGGGGTAGTTGAAACCTTTTGACTTTAGGAGAGTTAAAAATGTCA
SQ  TCTGAGCCAGGCATTGGTGGCGCACACCTTTATCCCAGCACTTGGGAGGCAGAGGCAGGC
SQ  GGAGCTCTGTGAGTTCAAGGCCAGCCTGTCTCCAGAGCGAGTGCCAGGATAGGCACCAAA
SQ  GTTACACAGAGAAACTCTGTCTCAAAAAAAAAAAAAAAAACCTAAACCAAAATGTCATCT
SQ  GTTCAGAGTAAGGGGGTAGGAGAATTTGATGTGTTTATAGAAGATGAACATGTTGAGGAC
SQ  AGGAAAAGAAATCTTGACTAGAAAGGTTGACATTGATGTTGAGTGGCTCACTACACATAC
SQ  ACATGAAAGATCCTTCAGTATCACGCTATCTTGTTGTGAACTTGAAGACTGTTTCCCACC
SQ  AACTTTGTTCTGAAACTTGAGCATGCCTACAGTCCTGGGTTATCAGGCATTCAGTATATG
SQ  TTCGTACTGGATAAAAATTCCCTTTTCTCTTGTCTGTCCTTTTAAATTTAGAAACTTTCT
SQ  TTCAGATTTCAAGAAACATGCTTTAGGCACCTACTAAGTATTCTTCCTTTAGTTCTTTAT
SQ  TCTATGTGATATTCTTTTATGAGCTCCTCTCTCTTTCCCAGTCTTTATGCACTGAGTTAA
SQ  TGCTTCTTGTCAAGCTTGATCTCACTGAAAATAGCCTTTGGTTTATAGAAACAAACTGCA
SQ  TGTTGCTTTATAGTTTACCCTGGATAAAACTGGCAGTTTCTAAGTCTGTCCTAATTAAAG
SQ  CTTCCCAAGCCAAAAGATGGTGTAGAGGGTAGAGACTAGTGCTAATTATAAATATAAAAA
SQ  TAAGGCATACTGTTGGTCTTCTCTTGCTCCTACTCTAAAAAAGCAAGAGTTCTATTGGGA
SQ  TAGACTTCACCTCAGTGTGTTGTTAGTTGTGCATGGTCATGCCTGAATCTCAGCACGGGA
SQ  AGATGAGGTAGGAAGTCATGTGTTTGAAACCATTCCAGGGTGGAAATGACCTTGTGGCAA
SQ  AGGATGTTACTAGGCTCTGACTTCTTTCCCATCTGCTGGTTTGCCTTTGCCTGTGCCTCT
SQ  TTAAAATGGGAATGATTCTGAAATGAATGCTTTACCTTTTTGGAATCCTTATTTCAGATT
SQ  CACTGCAAGGGGTAAAATGTGTCATTTTAAGTAGATTCATTCTCTAGAAACAGACCCAAC
SQ  TACTCTTCTAGTTCTTTTGCATAGTCTAGATTTCTTTTTCAGCTGAAAAAATCTAAATGA
SQ  AGAGGAAGTGAAACTTGTTACTTTCCTCATTCTCTGTGTGTGATGGTTTTATTTTAGGTA
SQ  CAGTGGTAGTCTGTTTTCATGAAAATTCTAATGATTATAGAAAATCCTAATAACAGTAGA
SQ  AATGGAGGAAGAATTCTGTTTGTAATCGATTGTGTTGTGTGCCTTTCTTACGTAAATACT
SQ  GATGACCTAACTTAGCTGGGTGCAGGCAGCTGTTACAACTTGAGCTGACAATGTTGGTTG
SQ  TATGTTTCAGGTTCCAATACGTACGAAGAGGCAGCTGCTTACATTCAGTGCCAGTTTGAA
SQ  GATCTGAACCGAAGAAAAGATACCAAGGAGATCTACACTCACTTCACCTGTGCCACAGAC
SQ  ACCAAAAATGTGCAGTTTGTTTTTGATGCTGTTACAGATGTCATCATTAAAAACAACTTA
SQ  AAGGAATGTGGACTTTATTGAGAGGATGGCATTAGTAAAAGGTAAAACTTTAGACAGTTT
SQ  AGTTGCACTGTTATGGTGGGGTGTTTTGCCTTTGTAAATGTTTTTCTAATTGACAGTGTT
SQ  CTTCTTTTTTAGTTACTGCAATGAGTGTTGAGACCAGACATCATCTGCTGTCTCTTGGGT
SQ  CAGCTACAAGCATGGCGGGACCAGGGAATGGCAGCAGCATGCAGAATCTTAGCACTCTTT
SQ  AGCACAATCTTCTGTATTAGGGAATGTTTAGTTGGCATGAGATGTTCAAATCAGACATCG
SQ  GAATTGGAACAACTGTAAACTGTGGTTGACTCATCAAGGCATCACTTGGATTTTATATTC
SQ  TCAAATGTTTAGGGCATATTGAAGTCGAGGTGCTGCATTCCAGAACTTAAATATGTAGCT
SQ  CACTTTTTTTTCCTTTTTAAACAAATCACCCGTAGTTAATTTCTAAGGTTTTTCTCATCA
SQ  AGAGAAGAAAAACTAAAAAATCGTGCTTGTTTGCAAAAGAATCTTGAAAGAACTCAGTCT
SQ  TAACTATGCACATGATGTGACCAGACATCTTGAAAATATTCCTCTTAGTAGGAACTGTTT
SQ  GTTTTTTAGCTCTTGGTACGGTCAGACGCAATATTTCCATAATTAAAATTCTTCCTGGTT
SQ  ATTGGGACTACGTTAATATAGCTTTTCTGACTGAAATGTATGTTACTGTTATGTTTAACG
SQ  TGCCACGATGGCTTCTAACAGCAATTACTTGGAGAGTTCTACAGTATGCGTTTAGCTCTC
SQ  ATTTCTTTAAGCTTATGGTTGAAGATTAACCTTGTTTATGCTGATTACCAAATTACTAGT
SQ  GAATACTGACGTAATATGATAAACTCCTCTTCTTGGATACAGACACACCCAGGATAGCTG
SQ  TCAATTAGATGTGCAAACTGCTAAATTGAGAACCAATGACTTGCTGCTACAGATCTACTA
SQ  AATTGACCACTTTGAGTCTTGTCTGTTTGTCTCAGTCATAGGGAATTTTGTATAAGGTGC
SQ  CTCTTGTTTTCCATCTCTGTGGCCTTTTTGGTTGGGAGACATCTCAAGTGTATTAACAGT
SQ  GTGTGCTTTTCTTTTGTAAATGTGGTGCCAAATCCCTGTTTGCCATCGTTTTTACTGTAG
SQ  CAATGCTAATTGTAGTAGTGATCCTTAGTTAGTATGTTCTTTTTCTAAAACTTGCATTTT
SQ  GGAACTTTTTTCCACTTTGTCATGTGTACAGATTTTAATCTGTTACAGCTGGCAGCAGTA
SQ  TTAAAACAGTGAGTAAAGAGTCCAGGTTTGCTCTGCTTGTAACTGGTCCTTTCTGGAAAT
SQ  CCTGTCTTGTGTTTCCTTTTGCCCCTCTTGAGTATGCTTTGGCCTTTGTCTAAGAGTGGG
SQ  TTTAGGTAGAAGGGGGTCTCTGAAAGTCTAGTTCTTCAATGTAGTAATATTATCAAATCT
SQ  AGGACTGAGGGCTTTATGTCCAGTCTATGTACAAGGGATATGAGTCATAATTAGCTTCTG
SQ  ATTTACATTCTGCTTGTGCTGAGAGCTACAGTTCTTTTGTACAATATTTAGCAAATGTCA
SQ  TTAACACTGAGTGGATCACTGAGGGATGGCAAACAGAGAATGCATTTTGAGCATTTCAGA
SQ  TCAGTAGTTGGAGCAGTGCCTTTTGAGGTCCAGTCTTTTCAGATTGGATCCGTTTCATCT
SQ  TTTGATGTTACCTCCTACTCATTTAAAAGGTTGATGGTCAGAACTGCTTTGGAAAGCAAG
SQ  CCACAGTGACCAGTGCCTTTGCTGGCAGCTTTTAAAATTTTTTAATTCTCACAGAAAATC
SQ  ATTATTATGCAGACAGTATAACTATTATCTGACAAGCATTTCTTTAGGGCTAGGAAAATA
SQ  CCATCGGAAAGAAAGAAAAGTGTTGATTTCAGTCAGCAATGGACTTAATTCCCACAGTGT
SQ  AGGGGTTCCTAAGTCTTACTCTGAATTTGTCTTTTCTTTATTGTATTCTGTAATATAAAA
SQ  ACATTGAAAACAAGAGCTAGTGAAATGTTGTTTTCATAACTTTTCTATACTTTGGGATTA
SQ  GTGAAATGGTGTTGATAATTAAAATAATAGATATCCAAATTTAATTTTACTTTAGAATGC
SQ  ATTTTGTATTTTCATTTGAATCTGTCTATTTTTTAAACCTTTCTATTAATTAAAAATACA
SQ  AGTTCTCCACTTCTTTGCCTCTACATACCACTTTTATTTGCTTTCTGTTTACACGAAGTC
SQ  ATTCTCATCATCCAGGTGCCTTCTTTTAGGACAGACGGGAGGCAGTTGAAGTTTTCAGCG
SQ  ATGACCTGAAGGGGAAAAATCACCTAAAGCTGTCTGAAGAGCTTCTTAGCTGTGAACTGT
SQ  TAAAGTGTTTCTGTTCAGCTAGGCTTTGAGATCACTACTTTGTATTTTGAAGAACATTTC
SQ  TTAGGCAGAGTCAGAATGTGAAAGTTAAACATCTTATGAGCCTGGAGGAAAAAAGATTGA
SQ  TGCCAAACGTTAGGAGTTTCCTCTGGAAAATGCTGGAGTTTTGTGATGGATAATGTTCAT
SQ  TTTGAGGTGGCCAGACCTTTGGACCATCTAAGAAGTCAGCTAAGAAAATTAATGTTGAAT
SQ  TAATAAAACACGATCAATAGACTTTATCCTTGGGAGGATGGCAACCATAACCTTTGTTGT
SQ  TGGCAGCCACATTTTCTCCTGAGTGGAAACTTGAGCAGATAGGAGATGGTCTCTCTTTCC
SQ  TTACCTAATCAGTTCAGGCAGGTAATAGACTACACCTTCTGCTGTGAAAGTCCCCAAACC
SQ  ATTACAGGTCCTTATCACACAGCCACTTACACACCTACCCCCCAAACACACACAGTTACT
SQ  GTTTCCAGCTACTTCTGTGAAGGACAACATACTTTAGAATTCGAATTCGTCAGGGTAGTA
SQ  CAGTTTTGTTTTTTCCACCCCATACCATGCCTGACTTGGCTTGGCGCTTCTCGGGAATGA
SQ  GATGACACTGGGGGTACATAGTTAGTTTATGCAGATTCCCTGACTAAACTGAACTAAATC
SQ  AAATCTCACAAAGACATCCTGGGAAAATGTGTGTGGGGGGGTGTTTGTTTGTTTTTGTTT
SQ  TTGTTTTTTTGTTTGCTTGTTTTACTAAATCCCTTAAGCAACTTGTGCCAAAAGTTGAGG
SQ  GCAACAGAACAGACTAATATTGACAAGAACACTTGAATCCATTACAGAACATACATAATC
SQ  TCAAAGTCACTAGTGAGTGACAGGAACTTTGAATACTTCTGGGTGTTAGGGACATGACTC
SQ  TGTGGTTAAGAGCTCTGGCTGCTATTTCAGAGGCCTTATTTCAGTTCCCAGCACTCACAC
SQ  GGCAACTCACAACCGTCTATAGCTCCATCCCTGGGATTGTGACACCCTCTTCTGTGGACA
SQ  CCAGGTACAAGTGGTACACATACATATATACAGGCAAAACACTCATACACAGAAAATAGA
SQ  AATGTCTTAAATTTTTATATTTTTCACACTTTAAAGTGCCTTTCACACAAACAATTGGTG
SQ  TAAGGATTGGTGGGTCAAAAACATCCCTACATCTTAGGTGCAGAGTATTTAATTTTTATA
SQ  TAAAATTTCAAAAGACACTTAAGATACCCAAACATATATTTCTACTTCAGTTGTTTATAG
SQ  TATTTATAAGCAGTGAAAGGTTTAAAAATTCCATGACAAGTGACTATTAAATGTAATAAC
SQ  AGATGAATGTGCACTTATGGGGATCACAAGGTGGCAGAAGTAATAAATAATTAGTGATAC
SQ  ATTATTGCAGTGTATTAACATTGATTTTGTGTGGTCTGGCTTATATCATTTCCTATCTCT
SQ  AGGCCCACCTCAATATTCGTTGGGCTACTCAGACATTTTAACTGAGAAGTTTGTTTGTGA
SQ  GATTCCCCACAAGTAATACAAGAAATTACTTTTTTCTCTTTTTATCTTTGCTCATGTAGG
SQ  ACAAAAGTCCTGAGACCTCTTAGAAATCTTAGGAGCCTGAGAATTACTTGGCGTACTGAG
SQ  TTCTGCTCTTTTCTCGGCTTTTCCTAAGCCACGAACGTTTGAACAGGTCGCTTTCAGTCT
SQ  TACATTCCTTTTGTGTTGTCCAAAGATGGGCTGCATTTAACAGGGCAAAGACCTTTGTTT
SQ  TGTATTTCAGCCATCCTTATTTTCTGTTCACACTGGTATGTTCCCTTCTACTATCTCAGT
SQ  ATGCCTGTCTGACCTACAAAAACTTCACGTTGTTAACAAGCGGCAACCCCAGAGGCACTT
SQ  GCTGTCCCTGCTGGAATCTGTGCTCTGAGGGCTGTGCTGGGTAGAAAGGGCAGGGGGAGG
SQ  TAAGCCCTCTTCCCCCTTCACCTCCCTCCCAGCATTGCTGCTGTGGCACCTCAAGAACGT
SQ  GTGAAGTGACTGGCTGGAGTAGAGACTCTGAAAGTATGTGTGTCTTTCACCAAATGACTG
SQ  CTGCTTTTGTGTCTCATTCCTTTATCTGCAG
SC  EMBL #X96549
XX
FT  361 - 378(EMBL): repeat [1]
FT  1628 - 1639(EMBL): repeat [1]
FT  1651 - 1665(EMBL): repeat [1]
FT  2004 - 2020(EMBL): repeat [1]
XX
SF  AT-rich sites [1]; Topo II sites [1]
XX
FF  overlaps with origin of replication oriGNAI3 [2]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: X96549; CAMAR7981
XX
RN  [1]
RX  MEDLINE; 98044969 PubMed; 9383712
RA  Fernandez, M. A., Baron, B., Prigent, M., Toledo, F.,
RA  Buttin, G., Debatisse, M.
RT  Matrix attachment regions and transcription units in a
RT  polygenic mammalian locus overlapping two isochores
RL  J. Cell. Biochem. 67:541-551 (1997)
RN  [2]
RX  MEDLINE; 99177323 PubMed; 10075990
RA  Toledo, F., Lachages, A.-M., Mayau, V., Debatisse, M.
RT  Initiation of DNA replication at the chinese hamster origin
RT  oriGNAI3 relies on local sequences and/or chromatin
RT  structures, but not on transcription of the nearby GNAI3
RT  gene
RL  Nucleic Acids Res. 27:1600-1608 (1999)
//