S/MARt DB - S/MAR

AC  SM0000037
XX
DT  1.1.1999 00:00:00 (created); ili
DT  13.10.2004 14:50:00 (updated); ili2
XX
NA  DROME$H1H3
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  1400 bp
XX
LO  39DE
DE  G000104; histone 3
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DE  G000105; histone 4
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 2
DE  G001248; histone 1
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 5
DC  caution: histone gene repeat!
DE  G001249; histone 2A
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 3
DE  G001300; histone 2B
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 4
DC  caution: histone gene repeat!

G000104;
histone 3
G000105;
histone 4
G001249;
histone 2A
G001300;
histone 2B
G001248;
histone 1

XX
SQ  GAAGCGGACGTTGCAACTGCAGAATCAGACATCTTTTTTACACTGAGAACACTTTTTTTC
SQ  TGTTAAAAATGGCTCGCGCGCTGCCTACCAACCTCCTTTGCTCTGATGAGAATCGAGGAG
SQ  GAGAGCACTTTAACAATGCTACTGACATCAGTCATTTACTATGTCGAAGTTTGCTTGAAG
SQ  TGTAAACTTTTTTTAATTTTTTAGTATTTTAAATCATTAATAAAAATAAGGTTTTAATAG
SQ  TTCTACACTTTTAAATAATTTTTTCGTCACTTTCCATTTTTAAAAGGTGTAATATGGGTT
SQ  TTGAGACTTTCAAATGTTGATTGAATTTTTATAATCAAATTTTTAACTGGACCAATTTAT
SQ  AAAAAAACATCTATTAAAATAAGAATCATGGCAAATATTTCACTAATTCGTAATGTTTAT
SQ  TAAAATTGAAACGTTCATCCCCTAGAAGGGCTTCTGAAAGAAGCGTCTATTATTAATTAA
SQ  GATACTTTATTACTTGATTTAAGTTCACATTGAACTACAGAAAAATTTGCTTTAAAGCAG
SQ  CATTCAGAAATAATTTTCGATCGTTAAAAATACAGATACTTTCTTAAATAACATAATATT
SQ  AATATAATAAATAATATTTTCTTAAATTATTAATGTGTTTGCTTGTTATTAATGTGTTTT
SQ  CATGCATATTTTAAAATAATTTGTTCTGAAATCAATCGATTTCCTCGCCACATATGCATT
SQ  ACCGTCTATGTAGTCAAATAAATAAATCAAATAAAAAATAAAAAGAAACAATTTTTGTAT
SQ  TATCCTTTATTATGTAATATATATTACATTCCGCAACAAAATTAGCCAATTTCCGTGCTG
SQ  AATTTTACATAGGTTTTATTTTTTACAGACGTTTGAAGGGACAGTGTCAATTGTCCCGTA
SQ  CGACCTCTTCAATAATAACACATTCTTCAGTTAACACATGGAAAAAATATAAAATAGCTA
SQ  GTTTTATTTTATTATTTTCTGTTATTTTATAAATATTGCCGTCATCAATGTAATTTCATT
SQ  AATTTCAAACTGTCTTACACAGAATTCAGATTTTTTTTTTAGATGTTTAAGGTTCAGAGT
SQ  CCCTTGCCCCGCACGACACTTTCACTGCTTTAAAGGATGTTCGCACAAAGAACAAATAAA
SQ  AATATATATTTTTGTATTAACCTCTTCTTTAATTTAATAAATGTTGAGCTGACAATTAAA
SQ  ATAAGATTATTTTTATTCCTTCTCTGGCAGAATTAGTATTTTTACATATGATTTACCGTT
SQ  TATATGTACCGTTTGCGCCATAAATAATAGAATATGAATTTTGTTCTTATTTTTTTTTTA
SQ  AAGTTATAAATAGTCGGCAACAGAAAATTTTATCTCATTGAATCTGGTTTGTGGTCCTGA
SQ  AAAGGACCGATTATAGAGTA
SC  EMBL #X60225
XX
FT  383 - 1042: MAR-DNA [2]
FT  383 - 1042: bent DNA [5]
XX
SF  AT-rich sites (6982]; topoisomerase II cleavage sites
SF  [2] [7]; contains perfect match to the ARS consensus
SF  from budding yeast [6]; A box and T box elements
SF  [3]; present in each copy of the histone repeat unit
SF  but about one quater lack a 200 bp fragment containing the
SF  Eco RI site proximal to H3 [1]
XX
TP  facultative [13]
XX
FF  mediates ARS activity in fission yeast but not in budding
FF  yeast [6]; electroelutable from encapsulated and
FF  digested nuclei [13]
XX
EV  in vitro selection of S/MAR [6]
EC  matrices from S. cerevisiae and S. pmbe
XX
BF  SB000002; lamin A [10]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000002; lamin A [10]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
BF  SB000002; lamin A [10]
MM  replacement by chromomycin; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [10]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [8]
MM  southwestern blotting; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [10]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [10]
MM  replacement by chromomycin; 
SO  rl; rat
QA  6
BF  SB000004; lamin C [10]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000004; lamin C [10]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
BF  SB000004; lamin C [10]
MM  replacement by chromomycin; 
SO  rl; rat
QA  6
BF  SB000019; MFP1 [12]
MM  southwestern blotting; 
SO  rec(tomato-E.coli); tomato
QA  6
BF  SB000022; topoisomerase II [4]
MM  gel retardation; 
SO  Drosophila; Drosophila melanogaster
QA  6
BF  SB000028; HMG I(Y) [9]
MM  direct gel shift; 
PR  310 bp fragment
SO  rec(human-); human
QA  6
BF  SB000034; MATH20 [11]
MM  direct gel shift; 
PR  310 bp subfragment
SO  rec; 
QA  6
BF  SB000036; NuMA [10]
MM  sedimentation assay; 
SO  rec(human-baculovirus-Sf9); human
QA  6
BF  SB000037; desmin [10]
MM  sedimentation assay; 
SO  stomach; chicken
QA  6
BF  SB000053; topoisomerase II [4]
MM  nitrocellulose filter binding; 
SO  HeLa; human
QA  6
BF  SB000109; PEP [14]
MM  southwestern blotting; 
PR  657 bp Hinf I - EcoR I fragment [14]
SO  Kc; Drosophila
XX
DR  EMBL: X60225; DMH1H3
XX
RN  [1]
RX  MEDLINE; 85024896 PubMed; 6091913
RA  Mirkovitch, J., Mirault, M.-E., Laemmli, U. K.
RT  Organization of the higher-order chromatin loop: specific
RT  DNA attachment sites on nuclear scaffold
RL  Cell 39:223-232 (1984)
RN  [2]
RX  MEDLINE; 86106203 PubMed; 3002631
RA  Cockerill, P. N., Garrard, W. T.
RT  Chromosomal loop anchorage of the kappa immunoglobin gene
RT  occurs next to the enhancer in a region containing
RT  topoisomerase II sites
RL  Cell 44:273-282 (1986)
RN  [3]
RX  MEDLINE; 86272100 PubMed; 3015418
RA  Gasser, S. M., Laemmli, U. K.
RT  Cohabitation of scaffold binding regions with
RT  upstream/enhancer elements of three developmentally
RT  regulated genes of D. melanogaster
RL  Cell 46:521-530 (1986)
RN  [4]
RX  MEDLINE; 89315824 PubMed; 2546156
RA  Sperry, A. O., Blasquez, V. C., Garrard, W. T.
RT  Dysfunction of chromosomal llop attachment sites:
RT  Illegitimate recombination linked to matrix association
RT  regions and topoisomerase II
RL  Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989)
RN  [5]
RX  MEDLINE; 89377314 PubMed; 2505984
RA  Homberger, H. P.
RT  Bent DNA is a structural feature of scaffold-attached
RT  regions in Drosophila melanogaster interphase nuclei
RL  Chromosoma 98:99-104 (1989)
RN  [6]
RX  MEDLINE; 90377235 PubMed; 2118998
RA  Amati, B., Gasser, S. M.
RT  Drosophila scaffold-attached regions bind nuclear scaffolds
RT  and can function as ARS elements in both budding and
RT  fission yeast
RL  Mol. Cell. Biol. 10:5442-5454 (1990)
RN  [7]
RX  MEDLINE; 92164660 PubMed; 1311255
RA  Kaes, E., Laemmli, U. K.
RT  In vivo topoisomerase II cleavage of the Drosophila histone
RT  and satellite III repeats: DNA sequence and structural
RT  characteristics
RL  EMBO J. 11:705-716 (1992)
RN  [8]
RX  MEDLINE; 92405165 PubMed; 1525831
RA  Luderus, M. E. E., de Graaf, A., Mattia, E., den Blaauwen,
RA  J. L., Grande, M. A., de Jong, L., van Driel, R.
RT  Binding of matrix attachment regions to lamin B1
RL  Cell 70:949-959 (1992)
RN  [9]
RX  MEDLINE; 93345469 PubMed; 8344261
RA  Zhao, K., Kaes, E., Gonzalez, E., Laemmli, U. K.
RT  SAR-dependent mobilization of histone H1 by HMG-I/Y in
RT  vitro: HMG-I/Y is enriched in H1-depleted chromatin
RL  EMBO J. 12:3237-3247 (1993)
RN  [10]
RX  MEDLINE; 94344140 PubMed; 8065361
RA  Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B.,
RA  Compton, D. A., van Driel, R.
RT  Binding of matrix attachment regions to lamin polymers
RT  involves single-stranded regions and the minor groove
RL  Mol. Cell. Biol. 14:6297-6305 (1994)
RN  [11]
RX  MEDLINE; 96128118 PubMed; 8548801
RA  Strick, R., Laemmli, U. K.
RT  SARs are cis DNA elements of chromosome dynamics: synthesis
RT  of a SAR repressor protein
RL  Cell 83:1137-1148 (1995)
RN  [12]
RX  MEDLINE; 97112038 PubMed; 8953774
RA  Meier, I., Phelan, T., Gruissem, W., Spiker, S., Schneider,
RA  D.
RT  MFP1, a novel plant filament-like protein with affinity for
RT  matrix attachment region DNA
RL  Plant Cell 8:2105-2115 (1996)
RN  [13]
RX  MEDLINE; 96393045 PubMed; 8799833
RA  Hempel, K., Straetling, W. H.
RT  The chicken lysozyme gene 5' MAR and the Drosophila histone
RT  SAR are electroelutable from encapsulated and digested
RT  nuclei
RL  J. Cell Sci. 109:1459-1469 (1996)
RN  [14]
RX  MEDLINE;  PubMed; 9722628
RA  Hamann, S., Straetling, W. H.
RT  Specific binding of Drosophila nuclear protein PEP (protein
RT  on ecdysone puffs) to hsp70 DNA and RNA
RL  Nucleic Acids Res. 26:4108-4115 (1998)
//