S/MARt DB - S/MAR

AC  SM0000041
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$M0A9
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  321 bp
XX
LO  19q13.4
XX
SQ  GATCTCTGATGATGTCCATCCATAGGGAGATGGGGTCCAGGAAGCAAGACGGTCAGGGGA
SQ  GCAGACAGGCCCAGAGTATGGAGTTCCCAGGAGCCGCGGAAGAGGAGGCCACATGTAGGG
SQ  AAAAATCTCAACATCAGAAGACAGAGCGATGGGAGCACAGGAGAGCGGACGCTGGGTCCC
SQ  TCGTGCTGAGTAGTCAGGGCATGCCACAGTGAACAGCGCAGAACAGTAGAGGCTGCTTCG
SQ  TGTGGGTTGGAGGCACGTGCAGTGACTTGCAGGATTTGCACCGCAGCAAGGGTTAGGCTG
SQ  GGAAGGAAGCCGCCCACGACC
SC  EMBL #Z35290
XX
SF  inverted repeats [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z35290; HSCH19D3
XX
RN  [1]
RX  MEDLINE; 96188869 PubMed; 8614638
RA  Nikolaev, L. G., Tsevegiyn, T., Akopov, S. B., Ashworth, L.
RA  K., Sverdlov, E. D.
RT  Construction of a chromosome specific library of human MARs
RT  and mapping of matrix attachment regions on human
RT  chromosome 19
RL  Nucleic Acids Res. 24:1330-1336 (1996)
//