S/MARt DB - S/MAR

AC  SM0000042
XX
DT  1.1.1999 00:00:00 (created); ili
DT  4.9.2002 16:35:00 (updated); ili
XX
NA  PH$TDNA
XX
SY  petunia SAR GN1.5, 
XX
OS  Petunia hybrida
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  1664 bp
XX
SQ  TCTAGATGGTAGTTCAAACATATATGTATCAGGCACATTCATATATCTGGTCTTTCAATA
SQ  ATGATCAATTAGGCATATTTGCCAACCAATGAAATTATGATTAGTGGGAGTACTTAAATT
SQ  GAGCACATGCATGCTAATAGTCAATATTATTAGTCATTCCATTATATGATTTTTTTTGGC
SQ  TCAACTGACACCAAACTTAGCTTGCACGAGATTCTGTTCTCAACCTCCAGCTCTACGAGT
SQ  TTTCATCCTCATTGTGCGGATTAATCCAAAAGCGCTTTGAAGTTCTCGATACTTTAGTTC
SQ  GAGGCCTTTCTGGTTAACGTTAGACAGATCTCAACTATCTATCTTATACTTTGGTGGTGT
SQ  TGAAGTTGTGTGAACATCTCATTTAAAACTTAAGACTGATTCTTTTTCATGGGTCAAGCA
SQ  CGTATAATTTTTTTTTTAATTGTGGGTGATACTGAGCTTCGATCCCAGACCTCTGCCTGC
SQ  TCTGATACCATGTTAAAGTTGTATGATCATCTCATCTAAAAATTTAAGCGGTTAGATGTA
SQ  ACACACTTTATTAATTTAATTAGTTTCTCAACTGGTGGTTCCATGATAAGAATTTTCTTT
SQ  TACTATCGATTTCTTCCGTAAAATAATTTTTATATTGTATTTTAAACATTATTCAATATT
SQ  TGGGGTTGAGACCTTGTTTTCATTGTTGTTGAAACATTTCTATTCAGCAAGTTGCCAAGT
SQ  GCATTCAATCACTAGTTTCTCACACATGATTTATCTTATTTCAAATTTTAATCTTCCACC
SQ  AATTTAGGATAGATGCGCGGAAAGATATACGTAAGCTATAAGGTCGTAATATTCTCGGAT
SQ  AAATATCACAAAGCAGCTTAAAGATATTTATTGAGATTTTATAAGTGACTAGGAACAAAG
SQ  TGACCTTTACTAGTTTGAGAGGACATCAAAGGAACTTCCCGTTCTAAAGTGCTTCTTTTA
SQ  ATTGATTGGCCTTGAATTTTCTCACATGTTTATTTGTTATCGTTACTATTCAACACAAAG
SQ  AAAGTCACAAAGGGATGATCTCTTGGGACGACTTTGTTTATCTCCATTTAACTCTTTTTT
SQ  TTTTCTTTTTTTTTAAGAAAATAACACTGTATGGACATTTACTAGCCTTTTAAACAAAAA
SQ  ATAATAAACTCATTTTTCCTAAATTATGTGGTTTAGAGCCTGTTTGGCATTGCTGCCAAA
SQ  AACTGCTTATTTTGAAAAGTATTTTTGACATAAGTACTTTTTAAAGAAGTACTTTTAGAT
SQ  AATAAGCAGTTTGTGTTTGGACAACTCATTGGAGAAGTACTTTTGATAAATAATTTGTGT
SQ  TTGGTTAATCTTTACGGAAAGTACCTTTGAGTGTCAAATTACGAAAATGATATCCAAGTT
SQ  TATTTTACATTTGGATTAATAGCAACAAAAAATTATTTTTAATATTTATCATAAAAAAAT
SQ  TTAATTAAAAAAATTATTTAGTTAAAATGTAAAACATAAAGTAAAAGATGTAACTTTAAG
SQ  CTATTATTTATTTATTTTTTTGTTGCCAAACACCTCAAAATTCCAAAAAAAAAATACTTT
SQ  TCTTGAAAAAAAAAAGACACTTTTGGTTTTGGAGAAGCAATGCCAAACATGCTATTAAAT
SQ  ATTTAATCATCATTGTCAACTTTTTGTAGCCACTAGTCGCAATT
SC  EMBL #X67164
XX
FT  428 - 437(EMBL): T-box [1]
FT  1075 - 1084(EMBL): T-box [1]
FT  1471 - 1481(EMBL): similar to yeast ARS sequence [1]
FT  1512 - 1521(EMBL): T-box [1]
FT  1545 - 1554(EMBL): T-box [1]
FT  1566 - 1575(EMBL): T-box [1]
FT  1614 - 1627(EMBL): inverted repeat [1]
XX
SF  AT-rich [1]; ATATTT motif present 7 times [1]
XX
BP  80-100% [1]
XX
FF  T-DNA integration region [1]; enhances gene expression
FF  [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrices from mouse Ltk- cells and from pea leaves [1]
XX
BF  SB000017; hnRNP-U [2]
MM  sedimentation assay; 
SO  rec(human-E.coli); human
QA  6
BF  SB000084; T19P19.70 [2]
MM  sedimentation assay; 
SO  rec(A.thaliana-E.coli); Arabidopsis thaliana
QA  6
BF  SB000085; mlo1 [2]
MM  sedimentation assay; 
SO  rec(S.pombe-E.coli); fission yeast, Schizosaccharomyces pombe
QA  6
BF  SB000086; C43E11.1 [2]
MM  sedimentation assay; 
SO  rec(C.elegans-E.coli); Caenorhabditis elegans
QA  6
XX
DR  EMBL: X67164; PHTDNA
XX
RN  [1]
RX  MEDLINE; 94329432 PubMed; 8052530
RA  Dietz, A., Kay, V., Schlacke, T., Landsmann, J., Bode, J.
RT  A plant scaffold attached region detected close to a T-DNA
RT  integration site is active in mammalian cells
RL  Nucleic Acids Res. 22:2744-2751 (1994)
RN  [2]
RX  MEDLINE; 20459251 PubMed; 11003645
RA  Kipp, M., Goehring, F., Ostendorp, T., van Drunen, C. M.,
RA  van Driel, R., Przybylski, M., Fackelmayer, F. O.
RT  SAF-Box, a conserved protein domain that specifically
RT  recognizes scaffold attachment region DNA
RL  Mol. Cell. Biol. 20:7480-7489 (2000)
//