S/MARt DB - S/MAR

AC  SM0000043
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$IFC
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2895 bp
XX
SQ  AGATCTCTCAGAGTTTCTGATATTTCATATGGAGCCTTAGAATGTGTTTATAGCTGGACA
SQ  CATTGCCTCTGTTAATAAGGAAAACAAAGAAATACAGAATGGGTAATAGTTATAAAAACA
SQ  GCTGCAGCAATATCCAACAAAATACGGGAGAAAAGAGGAGAGGTGGAAAGTGATATAAAT
SQ  AAACTATAGTTAGAACATGAAGTCAAAAGCTATAGTCTAAATTGGTAAATCAATAAGGAT
SQ  TTTGGTACATTATGTAGATTTACATGGTTTATAATAAATGGCAAAAGAAAAGAAACAAAA
SQ  CGAAAAACAAGTTGCTTCCGTAGATTGGAAGTAGGGACGGAAAAGTGAGAAAGAATGTTT
SQ  TTTCATTTAATTGCATTGTATAAATCTTTCTTACACTTGTGCATGTGATGCAGTAATAAC
SQ  TGTAGAGAGAAGAATGTGAGCTTGTTTTTGTACTTCAGGCAGGTGAAACAGGATGGAATT
SQ  GTTACAAGTGTACCTAACATCAGTATTGAACACATAGTATTTGTGAATAAAAAAATTTAT
SQ  TTATAAAACAATTTTTAATAAAAGTAAAACTAAATATCTGCAAACTCCAAAAAAAATTAA
SQ  AAAGGAGAGAAGAAGAAGAATCACAAAAAGTGACCAATGTTAGAATATCTGGCACTCTTC
SQ  CATTTGGTGAGAGCCAGCCAGTACTTTTGATCAGTGCCTGGTCTAGGTTGGAAAGAAACT
SQ  AATTTCTTCTGAGTCAATAAAGTCAGTACCTTTAATGTTCTTTCTTCTCAGGTTTCCCAT
SQ  CTATAAATGAGAATAAGAATATCCCTTGTAAATTTATTTCAGAGAGATTGCTTTTTANAA
SQ  AAGTGTAGGAATCTGTGTCAAACATCAATTAGCTTTGAAAAGCAACCAATAGTCATTGAC
SQ  TCCATGCTTTAGAAATAACAAGCACCCAACATTAGTATAAAAAAATGCATTGGAATNCAA
SQ  AATAATATAATTTTCATATTATATTATTCTAGATATTCAAATATTTAGCAATTGGTATGA
SQ  TAGTGGAGGGCAGCAGAAAACAAGGCTGCCAAAAGCCTTAAAACTATATTCCCTTTGATT
SQ  CAGCAATTCATTTTCTAGTATTTTGTCCTAAGGAAATAATTAGACAAATTTTCCTTTTTG
SQ  TTGTTTTGTTTTGTTTTGTTTTCTTTGACATTGTTTTCCTTTTTCTTTTTAATTATACTT
SQ  TAAGTTTTAGGGTACATGTGCACAACGTGCAGGTTAGTTACATATGTATACATTGCCATG
SQ  TTGGTGTGCTGCACCCATTAACTCATCATTTAACATTAGGTGTATCTCCTAATGCTATCC
SQ  CTACCCCCTCCCCCAACCCCACAACAGGCCCCAGTGTGTGATGCTCCCCTTCCTGTGTCC
SQ  ATGTGTTCTCACTGTTCAATTCCCACCTATGAGTGAGAACATGTGGTGTTTGGTTTTTTG
SQ  TCCTTGCGATGGTTTGCTGAGAATGATGGTTTCCATCTTCATCCATGTCCCTACAAAGGA
SQ  CATGAACTCATCCTTTTTCATGGCTGCATAATATTCCACGGTGTATATGTGCCACATTTT
SQ  CTTAATCCAGTCTATCATTGTTGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTGAA
SQ  TAGTGCCGCAATAAACATACGTGTGCATGTGTCTTTATAGCAGCATGATTTATAATCCTT
SQ  TAGGTATATAGCCAGTAATGGGATTGCTGGGTCAAATGGTATTTCTAGTTCTAGATCCCT
SQ  GAGCAATCACCACACTGACTTCCACAATGGTCGAACTAGTTTACAGTCCCACCAACAGTG
SQ  TAAAAGTGTTCCTATTTCTCCACATCCTCTCCAGCACCTGTTGTTTCCTGACTTTTTAAT
SQ  GATCGCCATTCTAACTGGTGAGAGATGGTATCTCATTGTGGTTTTGATTTGCATTTCTCT
SQ  GATGGCCAGTGATGATGAGCATTTTTTCATGTGTCTTTTGGCTGCATAAATGAATTAGAC
SQ  ACATTTTCAAAAGGTGTTATACAAGGGTGTCTATTGGTTCAGACTTTGTAAACACTCCAA
SQ  ATTTAGGAGAAAAACATACATTTCTAACCTTCGAAGGTTAATTTTTAAAATTATGCTAAT
SQ  AAAAATTATACTAATTAAGAAAAATTATGCTAGATTTCTGTGTGTTGACTCAGAAAGTAT
SQ  TCCATAGCCAACATATTGTTAAGTGACAGAGATACATTCTAAACAATATGCATAATATAA
SQ  CCCCATTTTGTGGGAAAATCCATACATATATGAATAGAAAAGAGCCTAGAATTTAATATA
SQ  TAAAAATAGTAAGGTAAAAATCTGAGTGATAAATTTGTGAATGAATTTTCTTCTTTGTAT
SQ  TTTTTCTGAATATGGTACCACCTTTCAGAGCAGGTAATGATTTTTCCATTCATGTAGTAA
SQ  TAATAAAGCTATCTCAGTTTTAAGGACTGAAATATATTGTCTCCAATCCCTATCACAATC
SQ  CTAATGAGTCATTTGCTCTCGCTGTATCNTGACATTCCATTTACTACACAATGTCCCTGA
SQ  CAACAAGATAACTGAGAACATGAGCATAAGCTCTATTTGATATAGTTATAAGCCTAAACT
SQ  TAATTTCTGAGAATCACATAATGATACTACTTTACACCTTGATGTAATTTTAAAGTATAA
SQ  TTACTCACTCATAAGCCTATATCATTAGTAGAAAATGCACCAGATTGGGATTTAGGAGGC
SQ  TTCAGTACCTTTCCCTTCTTTGCTGCTGGCTCATTTGGGCAAATCGTTCTACAGGATTTC
SQ  TTAGGGGCCCATTGGGGATTTCAGAGGCTTGAGCCTATGTGATTTTTACTTCTATCACTC
SQ  AAAGTTTTAATGTTTTATCTGGTTTCTATCTCTCTTTAAGATTATAAGNGAATGTAAAGG
SQ  ACTTTTCCTGCTGGA
SC  [J. Bode, direct submission]
XX
BP  95-100% [J. Bode, direct submission]
XX
EV  in vitro selection of S/MAR 
EC  [J. Bode, direct submission]
XX
//