S/MARt DB - S/MAR

AC  SM0000044
XX
DT  1.1.1999 00:00:00 (created); ili
DT  17.12.2001 19:05:00 (updated); ili
XX
NA  MOUSE$IgHmu-5MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  384 bp
XX
DE  G000537; immunoglobulin heavy chain
DP  Direction: 5'; Pos 1: IgH enhancer
DN  Internal: y; 
XX
SQ  TCTAGAGAGGTCTGGTGGAGCCTGCAAAAGTCCAGCTTTCAAAGGAACACAGAAGTATGT
SQ  GTATGGAATATTAGAAGATGTTGCTTTTACTCTTAAGTTGGTTCCTAGGAAAAATAGTTA
SQ  AATACTGTGACTTTAAAATGTGAGAGGGTTTTCAAGTACTCATTTTTTTAAATGTCCAAA
SQ  ATTTTTGTCAATCAATTTGAGGTCTTGTTTGTGTAGAACTGACATTACTTAAAGTTTAAC
SQ  CGAGGAATGGGAGTGAGGCTCTCTCATACCCTATCCAGAACTGACTTTTAACAATAATAA
SQ  ATTAAGTTTAAAATATTTTTAAATGAATTGAGCAATGTTGAGTTGAGTCAAGATGGCCGA
SQ  TCAGAACCAGAACACCTGCAGCAG
SC  EMBL #V01523; nt 1-384
XX
FT  1 - 157: suspected to contain (a part of) an additional
FT             activating element [7]
FT  69 - 77: SATB1 binding [1]
FT  157 - 314: MAR-BP1 binding (RsaI-SspI fragment) [3]
FT  176 - 200: "P1 site", NF-muNR binding [3] [9]
FT  285 - 333: "P2 site", NF-muNR and Bright binding [6987,
FT               12159, 13403]
FT  293 - 302: SATB1 binding [1]
FT  313 - 320: SATB1 binding [1]
XX
BP  35% [J. Bode, direct submission]
XX
FF  dispensable for V(D)J recombination of the IgH locus
FF  [11]; overlaps with enhancer [3]; considered,
FF  together with SM0000045, as a functional part of the
FF  intronic muLCR [12]; not involved in assembling a stable
FF  nucleopotein complex at the adjacent enhancer but in
FF  generating an extended domain of histone acetylation
FF  [12]; necessary for repression by NF-muNR [9];
FF  required for high level expression [7]; may participate
FF  in gene control by increasing expression in lymphoid cells
FF  rather than by decreasing expression in nonlymphoid cells
FF  [2]; dispensable for normal expression in mature B
FF  cells [11]; essential for the transcription of the mu
FF  gene during normal lymphoid development [2];
FF  conflicting data concerning function in mature cell types
FF  vs. early embryogenesis only [2] [7]
XX
EV  in vitro selection of S/MAR 
EC  [J. Bode, direct submission]
XX
BF  SB000001; SATB1 [4]
MM  assessment of the dissociation constant; 0.1 nM
SO  thymus, mouse; mouse
QA  6
BF  SB000010; MAR-BP1 [3]
MM  UV-crosslinking; 
SO  WEHI 231; mouse
QA  6
BF  SB000010; MAR-BP1 [3]
MM  assessment of the dissociation constant; 15 nM
SO  WEHI 231; mouse
QA  6
BF  SB000011; NF-muNR [9]
MM  gel shift competition; 
PR  Xba I/Pvu II-fragment
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000011; NF-muNR [3]
MM  UV-crosslinking; 
SO  WEHI 231; mouse
QA  6
BF  SB000012; SATB1 [6]
MM  direct gel shift; 
SO  rec(human-); human
QA  6
BF  SB000012; SATB1 [1]
MM  missing base interference; 
SO  rec(human-); human
QA  6
BF  SB000020; nucleolin [4]
MM  assessment of the dissociation constant; 24 nM
SO  K562; human
QA  6
BF  SB000029; p53mut [8]
MM  southwestern blotting; 
PR  Xho I fragment containing 3' MAR as well [8]
SO  rec(mouse-); mouse
QA  6
BF  SB000029; p53mut [8]
MM  liquid phase binding assay; 
PR  Xho I fragment containing 3' MAR as well [8]
SO  rec(mouse-); mouse
QA  6
BF  SB000033; p53mut [8]
MM  liquid phase binding assay; 
PR  Xho I fragment containing 3' MAR as well [8]
SO  rec(human-); human
QA  6
BF  SB000044; Bright [5]
MM  direct gel shift; 
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000044; Bright [5]
MM  gel shift competition; 
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000054; Ku autoantigen [10]
MM  direct gel shift; 
SO  SK-BR 3; human
QA  6
BF  SB000054; Ku autoantigen [10]
MM  assessment of the dissociation constant; 0.2 nM
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [10]
MM  direct gel shift; 
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [10]
MM  assessment of the dissociation constant; 3 nM
SO  SK-BR 3; human
QA  6
BF  SB000110; SATB2 [13]
MM  chromatin immunoprecipitation (ChIP); 
SO  rec(mouse-); mouse
XX
DR  EMBL: V01523; MMIG33
XX
RN  [1]
RX  MEDLINE; 92370684 PubMed; 1505028
RA  Dickinson, L. A., Joh, T., Kohwi, Y., Kohwi-Shigematsu, T.
RT  A tissue-specific MAR/SAR DNA-binding protein with unusual
RT  binding site recognition
RL  Cell 70:631-645 (1992)
RN  [2]
RX  MEDLINE; 94345393 PubMed; 8066460
RA  Forrester, W. C., van Genderen, C., Jenuwein, T.,
RA  Grosschedl, R.
RT  Dependence of enhancer-mediated transcription of the
RT  immunoglobulin mu gene on nuclear matrix attachment regions
RL  Science 265:1221-1225 (1994)
RN  [3]
RX  MEDLINE; 96025779 PubMed; 7592598
RA  Zong, R.-T., Scheuermann, R. H.
RT  Mutually exclusive interaction of a novel matrix attachment
RT  region binding protein and the NF-muNR enhancer repressor
RL  J. Biol. Chem. 270:24010-24018 (1995)
RN  [4]
RX  MEDLINE; 95098023 PubMed; 7799955
RA  Dickinson, L. A., Kohwi-Shigematsu, T.
RT  Nucleolin is a matrix attachment region DNA-binding protein
RT  that specifically recognizes a region with high
RT  base-unpairing potential
RL  Mol. Cell. Biol. 15:456-465 (1995)
RN  [5]
RX  MEDLINE; 96127903 PubMed; 8543152
RA  Herrscher, R. F., Kaplan, M. H., Lelsz, D. L., Das, C.,
RA  Scheuermann, R. H., Tucker, P. W.
RT  The immunoglobulin heavy-chain matrix-assocating regions
RT  are bound by Bright: a B cell-specific trans-activator that
RT  describes a new DNA-binding protein family
RL  Genes Dev. 9:3067-3082 (1995)
RN  [6]
RX  MEDLINE; 97269059 PubMed; 9111059
RA  Dickinson, L. A., Dickinson, C. D., Kohwi-Shigematsu, T.
RT  An atypical homeodomain in SATB1 promotes specific
RT  recognition of the key structural element in a matrix
RT  attachment region
RL  J. Biol. Chem. 272:11463-11470 (1997)
RN  [7]
RX  MEDLINE; 97265399 PubMed; 9111336
RA  Oancea, A. E., Berru, M., Shulman, M. J.
RT  Expressin of the (recombinant) endogenous immunoglobulin
RT  heavy-chain locus requires the intronic matrix attachment
RT  regions
RL  Mol. Cell. Biol. 17:2658-2668 (1997)
RN  [8]
RX  MEDLINE; 98241021 PubMed; 9581865
RA  Will, K., Warnecke, G., Albrechtsen, N., Boulikas, T.,
RA  Deppert, W.
RT  High affinity MAR-DNA binding is a common property of
RT  murine and human mutant p53
RL  J. Cell. Biochem. 69:260-270 (1998)
RN  [9]
RX  MEDLINE; 99077966 PubMed; 9858552
RA  Wang, Z., Goldstein, A., Zong, R. T., Lin, D., Neufeld, E.
RA  J., Scheuermann, R. H., Tucker, P. W.
RT  Cux/CDP homeoprotein is a component of NF-muNR and
RT  represses the immunoglobulin heavy chain intronic enhancer
RT  by antagonizing the bright  transcription activator
RL  Mol. Cell. Biol. 19:284-295 (1999)
RN  [10]
RX  MEDLINE; 99329069 PubMed; 10400681
RA  Galande, S., Kohwi-Shigematsu, T.
RT  Poly(ADP-ribose) polymerase and Ku autoantigen form a
RT  complex and synergistically bind to matrix attachment
RT  sequences
RL  J. Biol. Chem. 274:20521-20528 (1999)
RN  [11]
RX  MEDLINE; 99145583 PubMed; 9990057
RA  Sakai, E., Bottaro, A., Davidson, L., Sleckman, B. P., Alt,
RA  F. W.
RT  Recombination and transcription of the endogenous Ig heavy
RT  chain locus is effected by the Ig heavy chain intronic
RT  enhancer core region in the absence of the matrix
RT  attachment regions
RL  Proc. Natl. Acad. Sci. USA 96:1526-1531 (1999)
RN  [12]
RX  MEDLINE; 20565754 PubMed; 11113195
RA  Fernandez, L. A., Winkler, M., Grosschedl, R.
RT  Matrix attachment region-dependent function of the
RT  immunoglobulin mu enhancer involves histone acetylation at
RT  a distance without changes in enhancer occupancy
RL  Mol. Cell. Biol. 21:196-208 (2001)
RN  [13]
RX  MEDLINE;  PubMed; 14701874
RA  Dobreva, G., Dambacher, J., Grosschedl, R.
RT  SUMO modification of a novel MAR-binding protein, SATB2,
RT  modulates immunoglobulin mu gene expression
RL  Genes Dev. 17:3048-3061 (2003)
//