S/MARt DB - S/MAR

AC  SM0000045
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 10:57:00 (updated); ili
XX
NA  MOUSE$IgHmu-3MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  314 bp
XX
DE  G000537; immunoglobulin heavy chain
DP  Direction: 3'; Pos 1: IgH enhancer
DN  Internal: y; 
XX
SQ  AATTCATTTTCAAAATTAGGTTATGTAAGAAATTGAAGGACTTTAGTGTCTTTAATTTCT
SQ  AATATATTTAGAAAACTTCTTAAAATTACTCTATTATTCTTCCCTCTGATTATTGGTCTC
SQ  CATTCAATTATTTTCCAATACCCGAAGTCTTTACAGTGACTTTGTTCATGATCTTTTTTA
SQ  GTTGTTTGTTTTGCCTTACTATTAAGACTTTGACATTCTGGTCAAAACGGCTTCACAAAT
SQ  CTTTTTCAAGACCACTTTCTGAGTATTCATTTTAGGAGAAATATTTTTTTTTTAAATGAA
SQ  TGCAATTATCTAGA
SC  EMBL #V01523; nt 684-997
XX
FT  57 - 67: SATB1 binding [2]
FT  59 - 70: "P3 site", potential NF-muNR and weak Bright
FT             binding [4] [6]
FT  59 - 64: important for recognition by the SATB1
FT             homeodomain-like domain [7]
FT  61 - 69: ATATTT box [1]
FT  73 - 98: low affinity SATB1 binding [2]
FT  105 - 143: "P4 site", NF-muNR binding [4] [9]
FT  107 - 117: low affinity SATB1 binding [2]
XX
SF  mutation of the ATATTT box decreases binding potential
SF  [1]
XX
BP  86% [J. Bode, direct submission]
XX
FF  dispensable for V(D)J recombination of the IgH locus
FF  [11]; overlaps with enhancer [4]; considered,
FF  together with SM0000044, as a functional part of the
FF  intronic muLCR [13]; not involved in assembling a stable
FF  nucleopotein complex at the adjacent enhancer but in
FF  generating an extended domain of histone acetylation
FF  [13]; necessary for repression by NF-muNR [9];
FF  required for high level expression [8]; may participate
FF  in gene control by increasing expression in lymphoid cells
FF  rather than by decreasing expression in nonlymphoid cells
FF  [3]; dispensable for normal expression in mature B
FF  cells [11]; essential for the transcription of the mu
FF  gene during normal lymphoid development [3];
FF  conflicting data concerning function in mature cell types
FF  vs. early embryogenesis only [3] [8]
XX
EV  in vitro selection of S/MAR 
EC  [J. Bode, direct submission]
XX
BF  SB000001; SATB1 [5]
MM  assessment of the dissociation constant; 1 nM
SO  thymus, mouse; mouse
QA  6
BF  SB000010; MAR-BP1 [4]
MM  UV-crosslinking; 
SO  WEHI 231; mouse
QA  6
BF  SB000011; NF-muNR [9]
MM  gel shift competition; 
PR  EcoR I/Xba I-frragment
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000011; NF-muNR [4]
MM  UV-crosslinking; 
SO  WEHI 231; mouse
QA  6
BF  SB000012; SATB1 [7]
MM  direct gel shift; 
SO  rec(human-); human
QA  6
BF  SB000012; SATB1 [2]
MM  missing base interference; 
SO  rec(human-E.coli); human
QA  6
BF  SB000012; SATB1 [2]
MM  replacement by distamycin A; 
SO  rec(human-ret lys); human
QA  6
BF  SB000028; HMG I(Y) [12]
MM  direct gel shift; 
SO  rec(human-E.coli); human
QA  6
BF  SB000044; Bright [6]
MM  direct gel shift; 
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000044; Bright [6]
MM  gel shift competition; 
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000054; Ku autoantigen [10]
MM  direct gel shift; 
SO  SK-BR 3; human
QA  6
BF  SB000054; Ku autoantigen [10]
MM  assessment of the dissociation constant; 0.05 nM
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [10]
MM  direct gel shift; 
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [10]
MM  assessment of the dissociation constant; 1.8 nM
SO  SK-BR 3; human
QA  6
XX
DR  EMBL: V01523; MMIG33
XX
RN  [1]
RX  MEDLINE; 91027762 PubMed; 2223779
RA  Mielke, C., Kohwi, Y., Kohwi-Shigematsu, T., Bode, J.
RT  Hierarchical binding of DNA fragments derived from
RT  scaffold-attached regions: correlation of properties in
RT  vitro and function in vivo
RL  Biochemistry 29:7475-7485 (1990)
RN  [2]
RX  MEDLINE; 92370684 PubMed; 1505028
RA  Dickinson, L. A., Joh, T., Kohwi, Y., Kohwi-Shigematsu, T.
RT  A tissue-specific MAR/SAR DNA-binding protein with unusual
RT  binding site recognition
RL  Cell 70:631-645 (1992)
RN  [3]
RX  MEDLINE; 94345393 PubMed; 8066460
RA  Forrester, W. C., van Genderen, C., Jenuwein, T.,
RA  Grosschedl, R.
RT  Dependence of enhancer-mediated transcription of the
RT  immunoglobulin mu gene on nuclear matrix attachment regions
RL  Science 265:1221-1225 (1994)
RN  [4]
RX  MEDLINE; 96025779 PubMed; 7592598
RA  Zong, R.-T., Scheuermann, R. H.
RT  Mutually exclusive interaction of a novel matrix attachment
RT  region binding protein and the NF-muNR enhancer repressor
RL  J. Biol. Chem. 270:24010-24018 (1995)
RN  [5]
RX  MEDLINE; 95098023 PubMed; 7799955
RA  Dickinson, L. A., Kohwi-Shigematsu, T.
RT  Nucleolin is a matrix attachment region DNA-binding protein
RT  that specifically recognizes a region with high
RT  base-unpairing potential
RL  Mol. Cell. Biol. 15:456-465 (1995)
RN  [6]
RX  MEDLINE; 96127903 PubMed; 8543152
RA  Herrscher, R. F., Kaplan, M. H., Lelsz, D. L., Das, C.,
RA  Scheuermann, R. H., Tucker, P. W.
RT  The immunoglobulin heavy-chain matrix-assocating regions
RT  are bound by Bright: a B cell-specific trans-activator that
RT  describes a new DNA-binding protein family
RL  Genes Dev. 9:3067-3082 (1995)
RN  [7]
RX  MEDLINE; 97269059 PubMed; 9111059
RA  Dickinson, L. A., Dickinson, C. D., Kohwi-Shigematsu, T.
RT  An atypical homeodomain in SATB1 promotes specific
RT  recognition of the key structural element in a matrix
RT  attachment region
RL  J. Biol. Chem. 272:11463-11470 (1997)
RN  [8]
RX  MEDLINE; 97265399 PubMed; 9111336
RA  Oancea, A. E., Berru, M., Shulman, M. J.
RT  Expressin of the (recombinant) endogenous immunoglobulin
RT  heavy-chain locus requires the intronic matrix attachment
RT  regions
RL  Mol. Cell. Biol. 17:2658-2668 (1997)
RN  [9]
RX  MEDLINE; 99077966 PubMed; 9858552
RA  Wang, Z., Goldstein, A., Zong, R. T., Lin, D., Neufeld, E.
RA  J., Scheuermann, R. H., Tucker, P. W.
RT  Cux/CDP homeoprotein is a component of NF-muNR and
RT  represses the immunoglobulin heavy chain intronic enhancer
RT  by antagonizing the bright  transcription activator
RL  Mol. Cell. Biol. 19:284-295 (1999)
RN  [10]
RX  MEDLINE; 99329069 PubMed; 10400681
RA  Galande, S., Kohwi-Shigematsu, T.
RT  Poly(ADP-ribose) polymerase and Ku autoantigen form a
RT  complex and synergistically bind to matrix attachment
RT  sequences
RL  J. Biol. Chem. 274:20521-20528 (1999)
RN  [11]
RX  MEDLINE; 99145583 PubMed; 9990057
RA  Sakai, E., Bottaro, A., Davidson, L., Sleckman, B. P., Alt,
RA  F. W.
RT  Recombination and transcription of the endogenous Ig heavy
RT  chain locus is effected by the Ig heavy chain intronic
RT  enhancer core region in the absence of the matrix
RT  attachment regions
RL  Proc. Natl. Acad. Sci. USA 96:1526-1531 (1999)
RN  [12]
RX  MEDLINE; 20047512 PubMed; 10582687
RA  Liu, W.-M., Guerra-Vladusic, F. K., Kurakata, S., Lupu, R.,
RA  Kohwi-Shigematsu, T.
RT  HMG-I(Y) recognizes base-unpairing regions of matrix
RT  attachment sequences and its increased expression is
RT  directly linked to metastatic breast cancer phenotype
RL  Cancer Res. 59:5695-5703 (1999)
RN  [13]
RX  MEDLINE; 20565754 PubMed; 11113195
RA  Fernandez, L. A., Winkler, M., Grosschedl, R.
RT  Matrix attachment region-dependent function of the
RT  immunoglobulin mu enhancer involves histone acetylation at
RT  a distance without changes in enhancer occupancy
RL  Mol. Cell. Biol. 21:196-208 (2001)
//