S/MARt DB - S/MAR

AC  SM0000046
XX
DT  1.1.1999 00:00:00 (created); ili
DT  29.5.2002 10:49:00 (updated); ili
XX
NA  AS$MAR
XX
OS  empty
OC  empty
XX
SZ  (25 bp)
XX
SQ  TCTTTAATTTCTAATATATTTAGAA
SC  [1]
XX
SF  usually the molecule used in experiment consists of
SF  multiple 25-bp units
XX
FF  derived from the IgH 3' enhancer MAR [1]; artificial MAR
FF  with unpairing properties [1] [2]; 25 bp unit needs to
FF  be repeated at least 3 times to yield matrix binding,
FF  strong matrix binding observed when the unit is repeated 7
FF  times or more [J. Bode, direct sumission]; (7x 25 bp)
FF  augment promoter activity when placed at the 3' end of an
FF  reporter gene [2]; (10 x 25 bp) enhance transgene
FF  expression but does not reduce expression variation in
FF  tobacco [11]
XX
BF  SB000001; SATB1 [3]
MM  direct gel shift; 
PR  (25)5
SO  rec(mouse-ret lys); mouse
QA  6
BF  SB000001; SATB1 [7]
MM  supershift (antibody binding); 
PR  (25)5
SO  VL3; mouse
QA  6
BF  SB000001; SATB1 [7]
MM  gel shift competition; 
PR  (25)5
SO  VL3; mouse
QA  6
BF  SB000012; SATB1 [6]
MM  direct gel shift; 
SO  rec(human-); human
QA  6
BF  SB000012; SATB1 [1]
MM  methylation interference; 
SO  rec(human-E.coli); human
QA  6
BF  SB000012; SATB1 [1]
MM  depurination interference; 
SO  rec(human-E.coli); human
QA  6
BF  SB000012; SATB1 [1]
MM  missing base interference; 
SO  rec(human-E.coli); human
QA  6
BF  SB000020; nucleolin [4]
MM  affinity chromatography; 
SO  K562; human
QA  6
BF  SB000020; nucleolin [4]
MM  direct gel shift; 
SO  K562; human
QA  6
BF  SB000020; nucleolin [4]
MM  gel shift competition; 
SO  K562; human
QA  6
BF  SB000020; nucleolin [4]
MM  replacement by distamycin A; 
SO  K562; human
QA  6
BF  SB000020; nucleolin [4]
MM  assessment of the dissociation constant; 9 nM
PR  25mer repeated 5times
SO  K562; human
QA  6
BF  SB000025; CDP [7]
MM  gel shift competition; 
PR  (25)5
SO  VL3; mouse
QA  6
BF  SB000026; SATB1 [8]
MM  gel shift competition; 
SO  thymus; rat
QA  6
BF  SB000028; HMG I(Y) [10]
MM  affinity chromatography; 
PR  (25)n
SO  MDA-MB-231; human
QA  6
BF  SB000028; HMG I(Y) [10]
MM  direct gel shift; 
PR  (25)7
SO  rec(human-E.coli); human
QA  6
BF  SB000028; HMG I(Y) [10]
MM  southwestern blotting; 
PR  (25)7
SO  MDA-MB-231; human
QA  6
BF  SB000030; p114 [5]
MM  southwestern blotting; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000030; p114 [5]
MM  assessment of the dissociation constant; 1 nM
PR  (25)2
SO  SK-BR 3; human
QA  6
BF  SB000054; Ku autoantigen [9]
MM  affinity chromatography; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000054; Ku autoantigen [9]
MM  direct gel shift; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000055; DNA-PK [9]
MM  affinity chromatography; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [9]
MM  affinity chromatography; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000062; PARP [9]
MM  direct gel shift; 
PR  (25)7
SO  SK-BR 3; human
QA  6
BF  SB000080; SATB1 [8]
MM  gel shift competition; 
SO  CCL64; mink
QA  6
BF  SB000110; SATB2 [13]
MM  direct gel shift; 
SO  rec(mouse-E.coli); mouse
BF  SB000110; SATB2 [13]
MM  gel shift competition; 
SO  rec(mouse-E.coli); mouse
BF  SB000114; PIASy [12]
MM  direct gel shift; 
SO  rec(mouse-E.coli); mouse
XX
RN  [1]
RX  MEDLINE; 92370684 PubMed; 1505028
RA  Dickinson, L. A., Joh, T., Kohwi, Y., Kohwi-Shigematsu, T.
RT  A tissue-specific MAR/SAR DNA-binding protein with unusual
RT  binding site recognition
RL  Cell 70:631-645 (1992)
RN  [2]
RX  MEDLINE; 92205331 PubMed; 1553545
RA  Bode, J., Kohwi, Y., Dickinson, L., Joh, T., Klehr, D.,
RA  Mielke, C., Kohwi-Shigematsu, T.
RT  Biological significance of unwinding capability of nuclear
RT  matrix-associating DNAs
RL  Science 255:195-197 (1992)
RN  [3]
RX  MEDLINE; 94158857 PubMed; 8114718
RA  Nakagomi, K., Kohwi, Y., Dickinson, L. A.,
RA  Kohwi-Shigematsu, T.
RT  A novel DNA-binding motif in the nuclear matrix attachment
RT  DNA-binding protein SATB1
RL  Mol. Biol. Cell 14:1852-1860 (1994)
RN  [4]
RX  MEDLINE; 95098023 PubMed; 7799955
RA  Dickinson, L. A., Kohwi-Shigematsu, T.
RT  Nucleolin is a matrix attachment region DNA-binding protein
RT  that specifically recognizes a region with high
RT  base-unpairing potential
RL  Mol. Cell. Biol. 15:456-465 (1995)
RN  [5]
RX  MEDLINE; 96147250 PubMed; 8564952
RA  Yanagisawa, J., Ando, J., Nakayama, J., Kohwi, Y.,
RA  Kohwi-Shigematsu, T.
RT  A matrix attachment region (MAR)-binding activity due to a
RT  p114 kilodalton protein is found in human breast carcinomas
RT  and not in normal and benign breast disease tissues
RL  Cancer Res. 56:457-462 (1996)
RN  [6]
RX  MEDLINE; 97269059 PubMed; 9111059
RA  Dickinson, L. A., Dickinson, C. D., Kohwi-Shigematsu, T.
RT  An atypical homeodomain in SATB1 promotes specific
RT  recognition of the key structural element in a matrix
RT  attachment region
RL  J. Biol. Chem. 272:11463-11470 (1997)
RN  [7]
RX  MEDLINE; 97364778 PubMed; 9218488
RA  Banan, M., Rojas, I. C., Lee, W. H., King, H. L., Harriss,
RA  J.V., Kobayashi, R., Web, C. F., Gottlieb, P. D.
RT  Interaction of the nuclear matrix-associated region
RT  (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR
RT  element (L2a) in an upstream regulatory region of the mouse
RT  CD8a gene
RL  J. Biol. Chem. 272:18440-18452 (1997)
RN  [8]
RX  MEDLINE; 97415606 PubMed; 9271405
RA  Liu, J., Bramblett, D., Zhu, Q., Lzano, M., Kobayashi, R.,
RA  Ross, S. R., Dudley, J. R.
RT  The matrix attachment region-binding protein SATB1
RT  participates in negative regulation of tissue-specific gene
RT  expression
RL  Mol. Cell. Biol. 17:5275-5287 (1997)
RN  [9]
RX  MEDLINE; 99329069 PubMed; 10400681
RA  Galande, S., Kohwi-Shigematsu, T.
RT  Poly(ADP-ribose) polymerase and Ku autoantigen form a
RT  complex and synergistically bind to matrix attachment
RT  sequences
RL  J. Biol. Chem. 274:20521-20528 (1999)
RN  [10]
RX  MEDLINE; 20047512 PubMed; 10582687
RA  Liu, W.-M., Guerra-Vladusic, F. K., Kurakata, S., Lupu, R.,
RA  Kohwi-Shigematsu, T.
RT  HMG-I(Y) recognizes base-unpairing regions of matrix
RT  attachment sequences and its increased expression is
RT  directly linked to metastatic breast cancer phenotype
RL  Cancer Res. 59:5695-5703 (1999)
RN  [11]
RX  MEDLINE; 21821076 PubMed; 11833772
RA  Nowak, W., Gawlowska, M., Jarmolowski, A., Augustyniak, J.
RT  Effect of nuclear matrix attachment regions on transgene
RT  expression in tobacco plants
RL  Acta Biochim. Pol. 48:637-646 (2001)
RN  [12]
RX  MEDLINE;  PubMed; 11731474
RA  Sachdev, S., Bruhn, L., Sieber, H., Pichler, A., Melchior,
RA  F., Grosschedl, R.
RT  PIASy, a nuclear matrix-associated SUMO E3 ligase,
RT  represses LEF1 activity by sequestration into nuclear bodies
RL  Genes Dev. 15:3088-3103 (2001)
RN  [13]
RX  MEDLINE;  PubMed; 14701874
RA  Dobreva, G., Dambacher, J., Grosschedl, R.
RT  SUMO modification of a novel MAR-binding protein, SATB2,
RT  modulates immunoglobulin mu gene expression
RL  Genes Dev. 17:3048-3061 (2003)
//