S/MARt DB - S/MAR

AC  SM0000047
XX
DT  1.1.1999 00:00:00 (created); ili
DT  28.5.2002 11:32:00 (updated); ili
XX
NA  HS$TOPO-M1
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  980 bp
XX
LO  20q12-q13.1
DE  G001035; topoisomerase I
DP  Direction: 3'
DN  Internal: y; Gene position numeral: 0
DC  intron 2
XX
SQ  CTGCAGCCTCAGACTCAATCAGGAAATACTTAGCATTATGCTCCAGGGTGGTTTTCTTCC
SQ  CTTACATTGCAACTGGACTCCTTGAGGCACCTTTTTAGAATTAGTGAGCCGCTAGGATTT
SQ  TTATACTATGCTTTGACATAAAAGAAAGTTGCTTGTCAATATGTGTTTTTTTAGTTTACC
SQ  AGCATATAGATCTCACAACAAATTTTAGGCTCGGATTGGATGTTTCTAGTAACAACAAGA
SQ  AAATCCAGGCATCACTAAAAGAATCAGAAATACGTTGTGGCTTGAAAGGTGCAAACTAAA
SQ  TAATATAGCTAGCAGTAACGGTCACCAACTCCTGCTTTTCTTTGGTTCAGTAGATAGAGT
SQ  AAAATGGAAAATAGGAAACCCAAGGTCAGTCCCCAAATCTCATTTTAACCAATAGCAGCA
SQ  AAAAAAAAAAAAAAAAAAAGGAATTGAGTCTGACTTTTTCCCTTGCTGTCAGCATAAAGA
SQ  TGGGGAATTGAGAGAGTTGGAAAGACATTCATTAGTTTGTTCAGATTATTAAATAACATG
SQ  TCTTAAAGTTTATATTCCAAAATTGGGCTGTGAGGTTTTTTTGTTTTGCTTGTTTTCAGT
SQ  GCATGTGTGGGGTGGGGAGGTGCAAAAAAATGTTTGCCTTCTAATATACAGCTTTGTTGT
SQ  ATATAATTATATAGTAACAGTTGTCCCTGCTGCTAATGGTATGGAAAATGATTCTGTTGT
SQ  GCTTTCTGAATACATATCATTTTAGAAGTTTCAGATTATACTAAAACCATGTTATTTCAT
SQ  ATTAGTTGGACATGAATGCATATTTATATGACACATCATTATCAACTTTTGCCTTTTGCC
SQ  ATCTTTTTAGTGCAAAGTAAAACTGATATTCTTCAAATCCAAAGTCGTTTCCTCAGAAGT
SQ  GTGTTTTGTGAGGGATTGCATCTTTCCCATGTGAAACTGAGTCGAACTCCAGTAAACTGT
SQ  GTTTGCTTGGGAAAATGAAT
SC  EMBL #L23998
XX
FF  reside in chromosomal region showing increased nuclease
FF  senstivity (6993]; no binding of hnRNP-U SB000017 or p300
FF  SB000089 in cells transfromed with adenovirus or SV40
FF  [2]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
BF  SB000017; hnRNP-U [2]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
BF  SB000089; p300 [2]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
XX
DR  EMBL: L23998; HSTOP1B
XX
RN  [1]
RX  MEDLINE; 94222087 PubMed; 8168528
RA  Romig, H., Ruff, J., Fackelmayer, F. O., Patil, M. S.,
RA  Richter, A.
RT  Characterization of two intronic nuclear-matrix-attachment
RT  regions in the human topoisomerase I gene
RL  Eur. J. Biochem. 221:411-419 (1994)
RN  [2]
RX  MEDLINE; 21907223 PubMed; 11909954
RA  Martens, J. H. A., Verlaan, M., Kalkhoven, E., Dorsman, J.
RA  C., Zantema, A.
RT  Scaffold/matrix attachment region elements interact with a
RT  p300-scaffold attachment factor A complex and are bound by
RT  acetylated nucleosomes
RL  Mol. Cell. Biol. 22:2598-2606 (2002)
//