S/MARt DB - S/MAR

AC  SM0000048
XX
DT  1.1.1999 00:00:00 (created); ili
DT  28.5.2002 11:36:00 (updated); ili
XX
NA  HS$TOPO-M2
XX
SY  MII, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2974 bp
XX
LO  20q12-q13.1
DE  G001035; topoisomerase I
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  intron 13
XX
SQ  GGATCCCAATAGGAGTCATTAAAGGCCTGGAAAAGTGGTGCCATTAGGAGAAAAAGAAAT
SQ  GATTTCTTGAGCTTGCTCTCAGTTCTCTTTTAGGCTGTCTTGTACTCAGCAGAATAGTGA
SQ  GATCTTCAAAGGTTGGGGTTTGATAGTGCCTTGAATAATTTTTAACTTTATATTGCCAGC
SQ  GGAAGAAGCATTCTCTTTTTAGATTTAAAAAATGTAGATACAAATATTAGGGGTTTTATT
SQ  TTTAGTGAAACATTTCAAACATACAGGAATAGATAATTATGTAATGAACACTCGTATGTC
SQ  CACCATCTGGCTTTGTAAAATCTTAAAATTATGTCTTATGTGCTCAATTGTTTTATTTCA
SQ  TAAAAGATACTGATAAACATAGCTGAAGTCACTTGTATACCATTCACCTTCTTCCCTGTA
SQ  GATTACTATGAACTCGGTCTTTTTATTCTCATACATATTTTTTGTATTTTTGCAGTATAT
SQ  TTATGTGTTCATAAACAATATGTAATTTTACAATATGTAACACACTAGTAACATACTAAT
SQ  TTAAAACTTGTTTTTAGTTTACAATATGTTGTAAACTATTGTAAGCTAAAGACATATTGT
SQ  ACAACCTATTGTTAAATAAAAACAGGTTTTAGTTTTAAATTAGGTATGTTACTGGGATCA
SQ  TTCTGCAACTTGTTTATTCCTCTCCAGCTTTGATTTTGTGGTTTTATTATCTTAACCTAC
SQ  ACTTTTAATTAATCCATTTTATTTGTTACATGGTATTCTATTATATCATAAAAACTTATC
SQ  TATTCTGTTGGTTTTTGTTGTTGGTCATTTGAGACCATGTCTTCGCTCTGTCACCCAGGC
SQ  TGGAGTACAGTGGCGTGATCTTGGCTCACTGTGACCTCTGCCTCCCGGATTCAAGTGGTT
SQ  TTGGTGCCTCAGCCTCCTGAGTAGCTGGGATTATAGGCGTGTGCCACCATGCCCAGCTAA
SQ  TTTTTGTATTTTTAATAGAGACGGGATTTCACCATGTTGGCCAGGCTGGTCTTGAACTGA
SQ  CCTCAAGTGATCTGCTCACCTCAGCTGCACAAAGTGCTGGGATTACAGGTGTTAGCCAAC
SQ  CAATACCCTGCCTCTATTCTCTTGTTAAGAGGCATTTAGCATGGTTAATACAGTCTCTTG
SQ  CCCTCATAAACAGTGCTGGGAAGGAAACACATGTTCTTGTGTATATTGAATGAAATTTGT
SQ  TTATACATTAGATATTTCCAAATGTTCTCTTTAAGTACTTCAGTTTACATCATTACTCTC
SQ  CTCCTCCCTCCCCTCCCACCCCCACCCACAACAGTATTCCTCTTTTTCCATATCCTTGCT
SQ  AATGTTTCAAAGTTTTGCTTTTTACATTTGGGTCTTAGATCCACTAGAATGTATTTTTGC
SQ  ATTGGGATGAAGTTGAAACCTAATATATTTTCCAAATGAGTAAACTGTTGTCACAGAACT
SQ  ATTTAGTTGTATTACCTCCTCTCTTGTATATCAGATATATCTACATATATGTCAGACTGT
SQ  TTCTGGGCTGTCTGTCCTCTTTAATTAGTTCGTGTATCTGTTTCTGCATCAGTAGCATAC
SQ  TGTCTTAACTACTGTAGCTTTATAAAGTCTATTGAGTAGGACAAGTTTGTTTCATTCTTC
SQ  AAAATTGCTTTGGCTATTCTTGGCCCTCTGCTGTTTCATATTAACTTTCAGATAAACTTG
SQ  TCAAATTCTAATGAAAACTGTTGATAAACTTGTTGATTAACAAATTCTAATAAAAACTGT
SQ  TGAGATTTTTATTGGAATTGCAATACATTTATAGATTAACGGAGAAAGATATTGACAATA
SQ  CAATTGAGTTTCCAATTCACGAACATGTTATACCTCTCCATTAATTCATGTCTTTTGAAT
SQ  GTATCCACCAATATGGTTTTGTAATTTTCTTCATAAAGGACATTTAAAATTCTTATTTTA
SQ  AGTGATCTTATAGTTTTATGCTAACGTGAATGAGATTTTTCCATTATGTTTCTGTTGGTT
SQ  ATTCCTGAAGTGGTAATGCTTATAATTTTGGGGTGTTGGTCTTGTATCTGGCAGCAGATA
SQ  CAAGAGGTGCTCAGAGTTGTTCAGGGTTGCTGAACTCTTAGTTCTAAAAGTGTCTGTCAT
SQ  TTGGGGTTTCTATGTAGATAATTTAATTATCTATAAAAACAGTTCTTCATTTTCAGTTCA
SQ  TATATTTCATATTTTCTTAAGTTTTAATTTTTATTTTTAAACACAATTATCCATAAACCC
SQ  TAACCCTTTCCCTAGTCAACAGCAGTCACAGCCAAATGTTTTATTAATTGCTATACTCAG
SQ  TGTTTCTTGTATCTCATACCTTCTGGGGTTTCTTGTCTTGTTGAAATACACCCTTTAATG
SQ  TTTCTTTAGTGAAGACCCAACAGTGGCACTCACTCACCTTTGTTTACCTGAAAATTTCTT
SQ  TATTTTCATCTTAATTCATAGTCTGTCTTTTCTCCAGTCAAGGAAGTGTCTTATAGGGAA
SQ  GATTCTGGTTTCACTATCGTGTATCCAGGATATATATGTATTTATAGATAGACTTTTAAT
SQ  CTGAGGACTAATGTATTTTATCCTACAGTATTACCAATCATTATTTCTTCCATAACTTCT
SQ  AGACCATTCCTTTTGTACTTCTTTTTTAGAGTCCTTATTAGATGAGTGTTGACTCTTTTC
SQ  AATCTAGACATCTTTTTTAAACTATATTTTCATACTCTTTGTCTCTTTAGGTCTGATTTT
SQ  TTAAGTTCAGGGGATATTTCATTTTGGGTGAGTTGTAGCACTACTTCAATTCACTAATTC
SQ  TAATTATATTTAATCTACAAGTTATTCCATCTATAATTTATTTCAATTACCACTTTTTGT
SQ  TTTCAAAATTTCTAATTTTATATCTGATTTTGTTTCATTTTTGTTTTATAATTTCATGTT
SQ  CTTTCTAGATTTTACATCTTTTTATGCATACTAAACATACTCACTTGAAAGTCTTTGTAA
SQ  GATTGTTCTATAAAATGTTACCTGAAGTGAATTC
SC  EMBL #L23999
XX
FT  830 - 1080(EMBL): contains repetitive sequences with
FT                    similarity to AluI elements [2]
FT  2631 - 2974(EMBL): contains one bent DNA region [2]
XX
FF  reside in chromosomal region showing increased nuclease
FF  senstivity [2]; no binding of hnRNP-U SB000017 or p300
FF  SB000089 in cells transfromed with adenovirus or SV40
FF  [6]
XX
EV  in vitro selection of S/MAR [2]
EV  in vivo selection/LIS [2]
XX
BF  SB000016; SAF-B [3]
MM  southwestern blotting; 
SO  HeLa; human
QA  6
BF  SB000017; hnRNP-U [1]
MM  nitrocellulose filter binding; 
SO  HeLa; human
QA  6
BF  SB000017; hnRNP-U [1]
MM  southwestern blotting; 
SO  HeLa; human
QA  6
BF  SB000017; hnRNP-U [5]
MM  replacement by distamycin A; 
SO  rec(human-E.coli); human
QA  6
BF  SB000017; hnRNP-U [5]
MM  sedimentation assay; 
SO  rec(human-E.coli); human
QA  6
BF  SB000017; hnRNP-U [6]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
BF  SB000023; SAF-B [4]
MM  direct gel shift; 
SO  rec(rat-); rat
QA  6
BF  SB000023; SAF-B [4]
MM  gel shift competition; 
SO  rec(rat-); rat
QA  6
BF  SB000084; T19P19.70 [5]
MM  sedimentation assay; 
SO  rec(A.thaliana-E.coli); Arabidopsis thaliana
QA  6
BF  SB000085; mlo1 [5]
MM  sedimentation assay; 
SO  rec(S.pombe-E.coli); fission yeast, Schizosaccharomyces pombe
QA  6
BF  SB000086; C43E11.1 [5]
MM  sedimentation assay; 
SO  rec(C.elegans-E.coli); Caenorhabditis elegans
QA  6
BF  SB000089; p300 [6]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
XX
DR  EMBL: L23999; HSTOP1C
XX
RN  [1]
RX  MEDLINE; 92371451 PubMed; 1324173
RA  Romig, H., Fackelmayer, F. O., Renz, A., Ramsperger, U.,
RA  Richter, A.
RT  Characterization of SAF-A, a novel nuclear DNA binding
RT  protein from HeLa cells with high affinity for nuclear
RT  matrix/saffold attachment DNA elements
RL  EMBO J. 11:3431-3440 (1992)
RN  [2]
RX  MEDLINE; 94222087 PubMed; 8168528
RA  Romig, H., Ruff, J., Fackelmayer, F. O., Patil, M. S.,
RA  Richter, A.
RT  Characterization of two intronic nuclear-matrix-attachment
RT  regions in the human topoisomerase I gene
RL  Eur. J. Biochem. 221:411-419 (1994)
RN  [3]
RX  MEDLINE; 96174649 PubMed; 8600450
RA  Renz, A., Fackelmayer, F. O.
RT  Purification and molecular cloning of the scaffold
RT  attachment factor B (SAF-B), a novel human nuclear protein
RT  that specifically binds to S/MAR-DNA
RL  Nucleic Acids Res. 24:843-849 (1996)
RN  [4]
RX  MEDLINE; 98337913 PubMed; 9671816
RA  Nayler, O., Straetling, W., Bourquin, J.-P., Stagljar, I.,
RA  Lindemann, L., Jasper, H., Hartmann, A. M., Fackelmayer, F.
RA  O., Ullrich, A., Stamm, S.
RT  SAF-B protein couples transcription and pre-mRNA splicing
RT  to SAR/MAR elements
RL  Nucleic Acids Res. 26:3542-3549 (1998)
RN  [5]
RX  MEDLINE; 20459251 PubMed; 11003645
RA  Kipp, M., Goehring, F., Ostendorp, T., van Drunen, C. M.,
RA  van Driel, R., Przybylski, M., Fackelmayer, F. O.
RT  SAF-Box, a conserved protein domain that specifically
RT  recognizes scaffold attachment region DNA
RL  Mol. Cell. Biol. 20:7480-7489 (2000)
RN  [6]
RX  MEDLINE; 21907223 PubMed; 11909954
RA  Martens, J. H. A., Verlaan, M., Kalkhoven, E., Dorsman, J.
RA  C., Zantema, A.
RT  Scaffold/matrix attachment region elements interact with a
RT  p300-scaffold attachment factor A complex and are bound by
RT  acetylated nucleosomes
RL  Mol. Cell. Biol. 22:2598-2606 (2002)
//