S/MARt DB - S/MAR

AC  SM0000049
XX
DT  1.1.1999 00:00:00 (created); ili
DT  16.8.2004 14:16:00 (updated); ili2
XX
NA  GG$LYS-3MAR
XX
OS  chick, Gallus gallus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; aves;
OC  neornithes; neognathae; galliformes; phasianidae
XX
SZ  3733 bp
XX
LO  1
DE  G000064; lysozyme
DP  Direction: 3'; 5216 - 8949; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  mentioned to be located 1300 to 5000 downstream of the
DC  lysozyme poly (A+) addition site in [1]
DE  G002969; glioma-amplified sequence
DP  Direction: 3'; 1315 - 5048; Pos 1: ATG
DN  Internal: y; 
DC  note: partial overlab with GAS41 gene [4]
XX
SQ  GAATTCTATGATGAAATGGTATGAAAATTTTAATGTCAACCGAGCCTGACTTTATTTAAA
SQ  AAAAATTATTGATGGTGCTGTGTATTTTGGTCCTTCCTTAGATATTTCAAGATCCTACTG
SQ  CCATGATGCAGCAACTGCTAACGACGTCCCGTCAGCTGACACTTGGTGCTTACAAGCATG
SQ  AAACAGAGTGTAAGTGCAAAATGAGGATACCTTCGCCGACCGTCATTCACTACTAATGTT
SQ  TTCTGTGGGATGTGATCGTACAGTGAGTTTGGCTGTGTGAAATTTGAATAGCTTGGTATT
SQ  GGCAGTGATGACGTGATCGATGCCTTGCTTATCATGTTTGAAATGAAGTAGAATAAATGC
SQ  AGCCTGCTTTATTTGAGATAGTTTGGTTCATTTTATGGAATGCAAGCAAAGATTATACTT
SQ  CCTCACTGAATTGCACTGTCCAAAGGTGTGAAATGTGTGGGGATCTGGAGGACCGTGACC
SQ  GAGGGACATTGGATCGCTATCTCCCATTTCTTTTGCTGTTACCAGTTCAGATTTTCTTTT
SQ  CACCTAGTCTTTAATTCCCAGGGTTTTGTTTTTTCCTTGGTCATAGTTTTTGTTTTTCAC
SQ  TCTGGCAAATGATGTTGTGAATTACACTGCTTCAGCCACAAAACTGATGGACTGAATGAG
SQ  GTCATCAAACAAACTTTTCTTCTTCCGTATTTCCTTTTTTTTCCCCCACTTATCATTTTT
SQ  ACTGCTGTTGTTGAGTCTGTAAGGCTAAAAGTAACTGTTTTGTGCTTTTTCAGGACGTGT
SQ  GCTTTCCAAATTACTGCCACATATATAAAGAAAGGTTGGAATTTTAAAGATAATTCATGT
SQ  TTCTTCTTCTTTTTTGCCACCACAGTTGCAGATCTTGAAGTAAAAACCAGGGAAAAGCTG
SQ  GAAGCTGCCAAAAAGAAAACCAGTTTTGAAATTGCTGAGCTTAAAGAAAGGTTAAAAGCA
SQ  AGTCGTGAAACCATCAACTGCTTAAAGAGTGAAATCAGAAAACTCGAAGAGGATGATCAG
SQ  TCTAAAGATATGTGATGAGTGTTGACTTGGCAGGGAGCCTATAATGAGAATGAAAGGACT
SQ  TCAGTCGTGGAGTTGTATGCGTTCTCTCCAATTCTGTAACGGAGACTGTATGAATTTCAT
SQ  TTGCAAATCACTGCAGTGTGTGACAACTGACTTTTTATAAATGGCAGAAAACAAGAATGA
SQ  ATGTATCCTCATTTTATAGTTAAAATCTATGGGTATGTACTGGTTTATTTCAAGGAGAAT
SQ  GGATCGTAGAGACTTGGAGGCCAGATTGCTGCTTGTATTGACTGCATTTGAGTGGTGTAG
SQ  GAACATTTTGTCTATGGTCCCGTGTTAGTTTACAGAATGCCACTGTTCACTGTTTTGTTT
SQ  TGTATTTTACTTTTTCTACTGCAACGTCAAGGTTTTAAAAGTTGAAAATAAAACATGCAG
SQ  GTTTTTTTTAAATATTTTTTTGTCTCTATCCAGTTTGGGCTTCAAGTATTATTGTTAACA
SQ  GCAAGTCCTGATTTAAGTCAGAGGCTGAAGTGTAATGGTATTCAAGATGCTTAAGTCTGT
SQ  TGTCAGCAAAACAAAAGAGAAAACTTCATAAAATCAGGAAGTTGGCATTTCTAATAACTT
SQ  CTTTATCAACAGATAAGAGTTTCTAGCCCTGCATCTACTTTCACTTATGTAGTTGATGCC
SQ  TTTATATTTTGTGTGTTTGGATGCAGGAAGTGATTCCTACTCTGTTATGTAGATATTCTA
SQ  TTTAACACTTGTACTCTGCTGTGCTTAGCCTTTCCCCATGAAAATTCAGCGGCTGTAAAT
SQ  CCCCCTCTTCTTTTGTAGCCTCATACAGATGGCAGACCCTCAGGCTTATAAAGGCTTGGG
SQ  CATCTTCTTTACTGCTTTGAGATTCTGTGTTGCAGTAACCTCTGCCAGAGAGGAGAAAAG
SQ  CCCCACAAACCTCATCCCCTTCTTCTATAGCAATCAGTATTACTAATGCTTTGAGAACAG
SQ  AGCACTGGTTTGAAACGTTTGATAATTAGCATTTAACATGGCTTGGTAAAGATGCAGAAC
SQ  TGAAACAGCTGTGACAGTATGAACTCAGTATGGAGACTTCATTAAGACAAACAGCTGTTA
SQ  AAATCAGGCATGTTTCATTGAGGAGGACGGGGCAACTTGCACCAGTGGTGCCCACACAAA
SQ  TCCTTCCTGGCGCTGCAGACCAATTTTTCTGGCATTCTGACTGCCGTTGCTGCTGGTCAC
SQ  AGAGAGCAACTATTTTTATCAGCCACAGGCAATTTGCTTGTAGTATTTTCCAAGTGTTGT
SQ  AGGTAAGTATAAATGCATCGGCTCCAGAGCACTTTGAGTATACTTATTAAAAACATAAAT
SQ  GAAAGACAAATTAGCTTTGCTTGGGTGCACAGAACATTTTTAGTTCCAGCCTGCTTTTTG
SQ  GTAGAAGCCCTCTTCTGAGGCTAGAACTGACTTTGACAAGTAGAGAAACTGGCAACGGAG
SQ  CTATTGCTATCGAAGGATCCTTGTTAACAAAGTTAATCGTCTTTTAAGGTTTGGTTTATT
SQ  CATTAAATTTGCTTTTAAGCTGTAGCTGAAAAAGAACGTGCTGTCTTCCATGCACCAGGT
SQ  GGCAGCTCTGTGCAAAGTGCTCTCTGGTCTCACCAGCCTTTTAATTGCCGGGATTCTGGC
SQ  ACGTCTGAGAGGGCTCAGACTGGCTTCGTTTGTTTGAACAGCGTGTACTGCTTTCTGTAG
SQ  ACATGGCCGGTTTCTCTCCTGCAGCTTATGAAACTGTTCACACTGAACACACTGGAACAG
SQ  GTTGCCCAAGGAGGCCGTGGATGCCCCATCCCTGGAGGCATTCAAGGCCAGGCTGGATGT
SQ  GGCTCTGGGCAGCCTGGTCTGGTGGTTGGCGATCCTGCACATAGCAGCGGGGTTGAAACT
SQ  CGATGATCACTGTGGTCCTTTTCAACCCAGGCTATTCTATGATTCTATGATTCAACAGCA
SQ  AATCATATGTACTGAGAGAGGAAACAAACACAAGTGCTACTGTTTGCAAGTTTTGTTCAT
SQ  TTGGTAAAAGAGTCAGGTTTTAAAATTCAAAATCTGTCTGGTTTTGGTGTTTTTTTTTTT
SQ  TTATTTATTATTTCTTTGGGGTTCTTTTTGATGCTTTATCTTTCTCTGCCAGGACTGTGT
SQ  GACAATGGGAACGAAAAAGAACATGCCAGGCACTGTCCTGGATTGCACACGCTGGTTGCA
SQ  CTCAGTAGCAGGCTCAGAACTGCCAGTCTTTCCACAGTATTACTTTCTAAACCTAATTTT
SQ  AATAGCGTTAGTAGACTTCCATCACTGGGCAGTGCTTAGTGAATGCTCTGTGTGAACGTT
SQ  TTACTTATAAGCATGTTGGAAGTTTTGATGTTCCTGGATGCAGTAGGGAAGGACAGATTA
SQ  GCTATGTGAAAAGTAGATTCTGAGTATCGGGGTTACAAAAAGTATAGAAACGATGAGAAA
SQ  TTCTTGTTGTAACTAATTGGAATTTCTTTAAGCGTTCACTTATGCTACATTCATAGTATT
SQ  TCCATTTAAAAGTAGGAAAAGGTAAAACGTGAAATCGTGTGATTTTCGGATGGAACACCG
SQ  CCTTCCTATGCACCTGACCAACTTCCAGAGGAAAAGCCTATTGAAAGCCGAGATTAAGCC
SQ  ACCAAAAGAACTCATTTGCATTGGAATATGTAGTATTTGCCCTCTTCCTCCCGGGTAATT
SQ  ACTATACTTTATAGGGTGCTTATATGTTAAATGAGTGGCTGGCACTTTTTATTCTCACAG
SQ  CTGTGGGGAATTC
SC  EMBL #AF410481; nt 14230-17963
XX
FT  1 - 18: exon 5 of GAS41 gene [4]
FT  102 - 289: exon 6 of GAS41 gene [4]
FT  866 - 1035: exon 7 of GAS41 gene [4]
XX
CH  boundary [2]
XX
FF  weaker affinity than LYS-5MAR SM0000031 [1]; coincides
FF  with the 3' boundary of the DNase I sensitive domain [2];
FF  invokes DNase I hypersensitive site [3]
XX
CP  HD11 [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
RN  [1]
RX  MEDLINE; 88283632 PubMed; 2840282
RA  Phi-Van, L., Straetling, W. H.
RT  The matrix attachment regions of the chicken lysozyme gene
RT  co-map with the boundaries of the chromatin domain
RL  EMBO J. 7:655-664 (1988)
RN  [2]
RX  MEDLINE; 90078221 PubMed; 2592370
RA  Levy-Wilson, B., Fortier, C.
RT  The limits of the DNase I-sensitive domain of the human
RT  apolipoprotein B gene coincide with the locations of
RT  chromosomal anchorage loops and define the 5' and 3'
RT  boundaries of the gene
RL  J. Biol. Chem. 264:21196-21204 (1989)
RN  [3]
RX  MEDLINE; 95023191 PubMed; 7937146
RA  Bonifer, C., Yannoutsos, N., Krueger, G., Grosveld, F.,
RA  Sippel, A. E.
RT  Dissection of the locus control function located on the
RT  chicken lysozyme gene domain in transgenic mice
RL  Nucleic Acids Res. 22:4202-4210 (1994)
RN  [4]
RX  MEDLINE; 21648904 PubMed; 11788708
RA  Chong, S., Riggs, A. D., Bonifer, C.
RT  The chicken lysozyme chromatin domain contains a second,
RT  widely expressed gene
RL  Nucleic Acids Res. 30:463-467 (2002)
//