S/MARt DB - S/MAR

AC  SM0000050
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 11:04:00 (updated); ili
XX
NA  RAT$GDH-5MAR
XX
OS  rat, Rattus norvegicus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  2078 bp
XX
DE  G001301; glutamate dehydrogenase
DP  Direction: 5'; 2010 - 1397; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G001301;
glutamate dehydrogenase

XX
SQ  AAGCTTTAGACTCTGGGTAGAATGTTCTGTTTCCTGTAATATAAAATCATAAAGTGATGA
SQ  TATTATCAAGTGAAAAGGAAATGTGGTACCTTAATCTTTCCACATCAAGCCAATATCATG
SQ  CTGAAGGCCAGAGAATCTTTTTTGCTAAAAAACACAATACAGATATAATTAATAGTTATC
SQ  ATTTATGTTTGATATTAATCATATGAATATAATTAATATGTTTTATTGTATCGATTATTG
SQ  TTGATATTAATGTAATTACTACTAATACATAACAAATATAACTAATGGTTATGGCTCAGT
SQ  AACTAAGGTAAGATATAAGCTACACTGGTAAAGAAAGATCAATATTGCTTCAGAGTACAC
SQ  TGAAGTAAATGAATAACTTAACCGGTCTAGGTTGTCACTTATATTTATACAACATTTTAA
SQ  GAACTAAGAACCTCTCTTCTATGCTTAGTAGATGAACAAAATCATGTAATAGATGAATGA
SQ  GGCCAGGAAGTACAAAGGTTTACAAAATTGCCAAGCCACTCTGGGGTGATTTTATGAGTA
SQ  ATGCGGCATTTGGTAGCTTGCCTTAAAGAATATTATTGGACATTATCAAGTGTGTGTGTG
SQ  TGTGTGTGTGTGTGTGTGTGTGTGTGTAACTGAACTCTCTTGTAGTTTCATTTTTGTTTG
SQ  AAAAAGACATGTATCTCATGTAGCCCAGGCTGGAATCAAACTCTATCCTTCTGTCTCCAC
SQ  CTCTCAGGTTCTGGGGTTCCTGGCATGCAGCACCCAAGCCCAGCTACCTCTGTGAAAACT
SQ  ATAACTTAGTAATCAGATCCTGGACCATTTAAAGAATATATATATATGTATGTGTGTGTG
SQ  TGTGTATATATATAATATATACATATGTATGTATATATACATATATATGTATGTGTATAT
SQ  ATGTATGTATAGAGAGGCTGACTATATATATATATATATATATGAGGCTGAATATATATA
SQ  TATATATGAATACACATACACATAGTGCCATGGCACATTCCTTTAATCTGAGCTCTCAGG
SQ  CAAAGGCAGACCAATCTCTGAGTTGTTCAAGGCCAGTGTGATCCATAGTCTCAGAAATTA
SQ  TATACTGAGACACTCCTGAGGATGTTATCACATTTCTAGTTTCCTTATCTTACTTTAGGA
SQ  CATGATTCCAAAAAAAAGGGGGGGGGGACACACAGTCAATGGTAGAGTTACAAGACTATG
SQ  CCGATGTGGTGACTCAAGAAGAGAGGGCTGAGGGAGCTGAAACAGGCATGTTCCCATGAA
SQ  TTCCGGGCAAGCCTAGGCTATAGAGTGAGACCACCATGATTTAAAAAAAAAAAAAAAGTG
SQ  GCACGCGAGAAAGTCAACAATGCTTTGCATAAGTGTTTTACCTCAAAATCGCTGAATAGT
SQ  TGACTAGAACAAATTAAAACCTTGTCCAAAGTCAAGGCCAGTGGGATCAGGGACTCCCTC
SQ  CAGTCCTGAAGCTTCTAGATTTCCCGTCCCTCAACAGCCCGATTCCGGATGAGTCTGGAC
SQ  TCCTCCAACGCCTCGGCGGCTTCAGCTCCGCGCCACTCTCCGGCCGGCCGCATAGCGGCC
SQ  GGCACACCATTCCGGCCCAGAGAGGAAAGGAGGGGCCTGGAGACTCACGCGGCCTGGGCT
SQ  GCTGGCCAGCCCTCGAGGCCTCCCTGCAGTCAGCTTCTACCTAATAGGCCGCCGCGCGTG
SQ  CACAGGGGGACCGACCTTCCGGGACGCGGACGCATCTTAGAGCTCTCAGGAGCCCGTGCC
SQ  TCCGGCCCGCGACCGGCGCGCGCCCCCGCTAGCCCCGCCCCCGCGAGCATGCGCACCAAG
SQ  CCCACCTGCGAGTGCGCGCCGCCGACGCCGACGCCGCACGCGCCGACGCCTGGAGGCCTG
SQ  GCGAGGCGCGGCCGAGGCAAGACCCAGCGCCCTGCGGCGCGCGGCCGCCGAAGTCCGTCC
SQ  TCCCGGTGGGGCGACAAGCGGCGCAGGGGAGGGGACAGCCAGACAAGCAGGAAGCTGCGG
SQ  CTTAAAAGGGCAGCTCGCGCCCAGCCCTTCCTCCCGCAGTCCAGGCCTGCAAGCTCTGAT
SQ  CTTCTGTGCTCCCGCCGCTCTCGCCTCAGCCCGCCGCC
SC  EMBL #X64365; nt 1-2078
XX
FT  1 - 614(EMBL): MAR-DNA [1]
FT  634 - 651(EMBL): putative topoisomerase II binding site
FT                   [1]
XX
SF  several AT-rich direct repeats [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
BF  SB000002; lamin A [2]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000003; lamin B1 [2]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000004; lamin C [2]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
XX
DR  EMBL: X64365; RNGLUDEHA
XX
RN  [1]
RX  MEDLINE; 93358903 PubMed; 8354285
RA  Das, A. T., Luderus, M. E., Lamers, W. H.
RT  Identification and analysis of a matrix-attachment region
RT  5' of the rat glutamate-dehydrogenase-encoding gene
RL  Eur. J. Biochem. 215:777-785 (1993)
RN  [2]
RX  MEDLINE; 94344140 PubMed; 8065361
RA  Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B.,
RA  Compton, D. A., van Driel, R.
RT  Binding of matrix attachment regions to lamin polymers
RT  involves single-stranded regions and the minor groove
RL  Mol. Cell. Biol. 14:6297-6305 (1994)
//