S/MARt DB - S/MAR

AC  SM0000051
XX
DT  1.1.1999 00:00:00 (created); ili
DT  17.12.1999 11:09:23 (updated); ili
XX
NA  AT$PC-MAR1
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  1320 bp
XX
LO  1
DE  G001302; plastocyanin
DP  Direction: 5'
DN  Internal: n; Gene position numeral: 2
DC  near RFLP marker g6838
DE  G001304; 
DP  Direction: 5'
DN  Internal: n; Gene position numeral: 1
DE  G001305; 
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -1
DE  G001306; alpha-amylase
DP  Direction: 5'
DN  Internal: n; Gene position numeral: -2

G001306;
alpha-amylase
G001305;
G001304;
G001302;
plastocyanin

XX
SQ  TGAAGATTTTGAACATTGTTTTTGTTATTGTTGGTTAATCCCACCATTTTTGTAACTTTT
SQ  TAATCAAATTAGTATATTTTTGTGTTGTAAGGTGACACTAATGAATTGATTTGTTATCCT
SQ  CCAACGTCGTCGTCATATAAAAGATTTTCTTTATTTATGGAAGAGAGAAGAATCTTATTT
SQ  GAACAAATGTTTATCGAATAAGAATCGGTAAAAAATGATTATAAGGAAGAAACGTGGAAC
SQ  CGAATCTACAGGCAGAGGGACGTGACGTTACATATGGGCAGAACCATATATAAAATCCCT
SQ  AATCGCACGTCAACCTCTCCGAAGCATAAGGCCATAACTTTTCCTATTTAAATTTCTTGT
SQ  CATTTTTACTATTTTAATTGTTATTTAGGGTAAATAAAAATGTCAGACTTCGATTGAGCC
SQ  CAATGAGTTTTTAGGGTGTGACTCCTATCACCGTCTGCACCTAATAAGTACTACTTTAAC
SQ  TTTCGCTTACCAATGCATGTCAATACTCAACAGTGACATATTTTTAATTTTCAGAGGTTT
SQ  TCAATGCCCAAAAACTTTGATATATAAAGATCGTACGAGTTTTAAATTCCTCACCTAAAA
SQ  ATTGTCAAGTATCATTAGTGTATAAAGTGCATAGATCGTGTTACAAATTCTTCACTTTCG
SQ  CTCTTATTTTTTGAATACTCACTATATATATAACACTAAAATAAAAGTGAAAGAATCTAA
SQ  TATGCTAAACCGGTAAAGAAAAAAAGCAAGACAGTCCGATTTTTAGATATTATCGATGTT
SQ  TTCATATAAATTAGACTTAAGAAATTTCAAAAATAAAATAATGATTGATTATGTTGGAAA
SQ  GAAATAGATGTGACCATATTTCGACTGCTCGTAAGCATAAAAACTAAAGTAGGTGGGGTG
SQ  CAATAATTACTTTTTAATTAATACAGTGAAAAAGTAATTAATACAGTATTAGTAGTATCA
SQ  GAAAAATTACAAAGCAACATCACTCAAAACGCCTCGAAAATAAAAACAATAATTTGAAAG
SQ  CAAATATATACACAATTATAAAGTTTAAAATTTTAAATTTCCTTATATCTATGTGGTATG
SQ  TATTAAAACTCACAAAAAGAAAGAAAATGACAAATCCTCACGTCCGTTACTTTTAAATCC
SQ  GTAGCAAAAATAAATAATTTAATTTTCTATCTCTATATCTCTCTGATTTAATCACAAATC
SQ  TTATCTTGAATCGTTATCTTTCTCTTCTTTCCTTAAACCAAAACCCAAAAAAGAGAGACC
SQ  AGACAAAAAAAAAAAACTCCCCAACAAAAAAAAGATATCTGTCTCTACTAAAAGTCTCTC
SC  EMBL #Z83321; nt 4321-5640
XX
FT  22 - 29: MRS: small half site motif (8/8) [2]
FT  209 - 229: MAR-specific signature [1]
FT  218 - 233: MRS: large half site motif (16/16) [2]
FT  357 - 372: MRS: large half site motif (15/16) [2]
FT  378 - 385: MRS: small half site motif (8/8) [2]
FT  513 - 528: MRS: large half site motif (16/16) [2]
XX
SF  putative sites for mouse topoisomerase II [1]; caution:
SF  4 MRS large half site motifs were mentioned in [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z83321; ATZ83321
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
RN  [3]
RX  MEDLINE; 20496822 PubMed; 11041885
RA  Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi,
RA  M., Meshi, T.
RT  AHM1, a novel type of nuclear matrix-localized, MAR binding
RT  protein with a single AT hook and a J
RT  domain-homologous region
RL  Plant Cell 12:1903-1916 (2000)
//