S/MARt DB - S/MAR

AC  SM0000052
XX
DT  1.1.1999 00:00:00 (created); ili
DT  16.12.1999 15:14:38 (updated); ili
XX
NA  AT$ATB2-5MAR
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  2145 bp
XX
LO  4
DE  G001341; 
DP  Direction: 5'; 2647 - 503; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  ATB2 may be transcription factor of the bZIP class

G001341;

XX
SQ  TATCAACTATCAAGTGTGTCGTACCATTCATGTAATTTCTTTTTTACTAATTTTGTTATA
SQ  TTTCTTTTTAACTGTTTTGATTTATTTATAAATAGACTAAAAAGTATGTTGAGTGAATAT
SQ  GTTTGGTGAAATTCATGCATCGTTTTTGGGAAGTGGGCTGGATCAGTGGATCTCTTCCAC
SQ  ACTTTCCCAAACTAATAAAGAGAAACTGAAAATAAATAAAAAACGAAAAAAGTTAAATTA
SQ  TTTAATCGTAATTTAAATTTTGTAAAACAATTTTTATAACTAAAACACCATCTGTGGTAA
SQ  GACGGTGGAATACATTAAGAATGTAGTATTAAATTACTACTCTACAAGTACTTAACTAAT
SQ  TATTATAATCCTTACATATTATCAGCATCTGAATAATTAACCCAGATTAATACGTATAAA
SQ  TCTTTCACAAATTGGAGAATAAGATTAGGAAATGAAAACAGCTGTATTGAGTCTGGAGAG
SQ  TTCGTATCCCAACCTCACATGTCCCTCTCACCTTTTCTTCTTCTTCGGCCTACTTACACA
SQ  TGTTCTTCTCATTTTACTCTAAGCACAGATTCTTTTGTATTTCTTAATCTCTTTTTATTT
SQ  TTATTTCAGGTTTTTTTTCATTTGATTATTCACAAATTAACTATTTTATTTAGTGTTGGT
SQ  GGTAATTGATTTTTAATTAGTTTCATAGATTTCTGCAGACAAATTCTGGCTTTCATGTTT
SQ  TTCTTTTTGCTTTTTTTTTTAATAATAATTCGCATTACAAATATATCATTAATTTTTCTT
SQ  TCTCTTTTGTCGTTACGTGAAAATAGATTTGCTGTGTGTTTTTTTTCTCCCGACAAATAT
SQ  AGACTTAGAGCATTTCCATCGCGAGTTTCTGGATTCTGGTCTATTAAAACAGAACAAAAA
SQ  ATTCAAAAAATGTGGAGAGAAAGTAAAAACGTTTCTCACTTGAGAAACTCATTTTTGCTT
SQ  TTGTTTTGTTTTGATTGGTTCAAATAATAATTAAAAAAATAAATAATAAAATAATAATAA
SQ  AATTTATATTATTTTATAAAAATGGGTTTCTCACCGATGGAGATGGTCTTACTGTTTTAC
SQ  TGAAGAAGATTTAATAAAGTTCTCGCTTCTTTTTTCCTCTGAGCTTAACTTTTTACTTTT
SQ  TGTGATAATAAAAAGAAGAAAACAAAGAAAAAGTTTTGTTTTCCTCTAAAACAAAGAATA
SQ  GTTTTATCTGCAATCTTTGTAAAAGAAACTGTACTTTGTTTTTTTTTTCAATTTCTTTCC
SQ  TCCTAAGAAATCACAGTACTAAACAAAACCAAAAGAAAAAAAGAAAAAAAAATTTAGGCA
SQ  GGTCAATTTTTAAGCTGGTCTGTTTTTGTGTGAGCTTTAATTTTCTGTCTTTGAAATATC
SQ  TTTATCTACCACGACAGTTTATAAAATTTGAAAGGGAAATTTATTTGGTATTAGGTTTCT
SQ  AAGAACTTCAATAAAGCTATATTTTCAATTACTTGTTATTAAATGCAAAAAAAAAATCTA
SQ  AATGGATGTTTAGGTATAACTGCAACAAAATTTATGGAAAAAACAAGACTTGATGAATGT
SQ  ATAATCTCAAGAGTTATTTTAAGCATAAATTTAAATCTAAATTTTCTATTTAAAATTATT
SQ  TGATGAATTTTTCTATTTTTAATTATGATAAATGCAAGATTCATAGTATCTAAATTTAAT
SQ  ACAGTATATGATTAGGCTTTTCATTAAACAATATAAATATTTTTTTATCTTGACATAATG
SQ  ATGAGTAAATAATTTACCAACTAAATACATATAATTTTTGATCAATACCATTCAAAAGAA
SQ  GAAAAAACACTTTCTCTTACTTATCTTTGAATTAATTTTGAAATATTTCATTAAGAAAAA
SQ  TTAATTGTTTAAAATATTGCTTTGATTAATGTAGACACTCCTCTAGAAAACTTTTTAAAG
SQ  GTTAGGGAAAAAATGTTACCAAAAAAAAGTTAGGAAAAAAATGTAAAAATAAAGAAAAGA
SQ  ATCTTCTTCCCCTAATAGAATCCAAACAAATGTATCGCTTACCATCAAGTTGCACAAACA
SQ  CTCAAAACGCTTTTTGATGATTTTTCTTCTATAAAATCTTTCTCCTCAACCATTTCAAAG
SQ  CCCCCTCTTCTCTCCTTCTCTCCCTTTTCTCTCTCTCTCGAAGAT
SC  EMBL #Z82043
XX
FT  741 - 448: MRS: small half site motif (8/8)
FT  920 - 935: MRS: large half site motif (15/16) [2]
FT  983 - 990: MRS: small half site motif (8/8)
FT  1002 - 1009: MRS: small half site motif (8/8)
FT  1010 - 1017: MRS: small half site motif (8/8)
FT  1025 - 1045: MAR-specific signature [1]
XX
SF  just 2 MRS smaller half site motifs were mentioned in
SF  [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z82043; ATZ82043
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//