S/MARt DB - S/MAR

AC  SM0000053
XX
DT  1.1.1999 00:00:00 (created); ili
DT  17.12.1999 10:42:30 (updated); ili
XX
NA  AT$PC-MAR2
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  540 bp
XX
LO  1
DE  G001302; plastocyanin
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -1
DE  G001304; 
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -2
DE  G001307; sterol methyltransferase
DP  Direction: 5'
DN  Internal: n; Gene position numeral: 1
DE  G001308; thioredoxin-like
DP  Direction: 5'
DN  Internal: n; Gene position numeral: 2

G001304;
G001302;
plastocyanin
G001307;
sterol methyltransferase
G001308;
thioredoxin-like

XX
SQ  GATCTATAAATAATTGTAGTTTTTCATTGTGATAACTGATTTGAGAAAACAAATATAAAC
SQ  GCAAGAAAAATTGTGATGTTACAAGGTGTTATTGGATTATAATTTAAAAGTAATTTTGAT
SQ  GCCTTTACTAAAATCATAGAAAGTAAATAAATTATAACCAAGTGCTAAAGAGTTTTTATA
SQ  ATCTTGTTATTAGTTATTCTATAATTTAGTGAAGTTTCTCAAACAATATATCTATTTGAT
SQ  GATTTTTTCATGATTTTATTTTGTGAAGAAAAATGTATAAAATTATAAACTAATAACACA
SQ  ATAGTTTAATTCATTAACAATCATACATTTTTTTTAATTAAACAACACAAAAAATTTATT
SQ  GACTTTATTAAATTTTGATTCTAATAAAATCAGATTTATGAAAATTTTAAAAGACTTTTA
SQ  ATTTACAAATCAAAAACTAATAATACATTTTAACAGAAATTAATAAAGTTTTGATTGAAT
SQ  AACAAGAGTCAAAAGATCTACTAAAGTTTTTAAAACAATATTTCAATCACAAACCATTTT
SC  EMBL #Z83321; nt 10681-11220
XX
FT  98 - 118: MAR-specific signature [1]
FT  151 - 166: MRS: large half site motif (15/16) [2]
FT  184 - 191: MRS: small half site motif (8/8) [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z83321; ATZ83321
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//