S/MARt DB - S/MAR

AC  SM0000055
XX
DT  1.1.1999 00:00:00 (created); ili
DT  17.12.1999 11:02:56 (updated); ili
XX
NA  AT$PC-MAR3
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  1441 bp
XX
LO  1
DE  G001307; sterol methyltransferase
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -2
DE  G001308; thioredoxin-like
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -1
DE  G001340; open reading frame
DP  Direction: 3'
DN  Internal: n; Gene position numeral: 1

G001307;
sterol methyltransferase
G001308;
thioredoxin-like
G001340;
open reading frame

XX
SQ  AAAAAGAGAACTCGATTTAATCTAGAAAGTAAATAAAACATATTGGAATTAGACTTTACT
SQ  TAACCGATAATGCCCCTAATTTGTTGAACAAATTTCTCTAAGTAAGGAAACTTTTAACAG
SQ  AATCTCTCAAAATCACCTAGATTTTAGCAGATTTTTGGACACACGTTTATTAGCTGATTA
SQ  CGATGTACGATGATTATTTCTTTAGGTACATAATATTGTTATTTTGATGTTGTAACACTA
SQ  ACCATTTAAAAGTATATGAAGCATAATAAGTCACCTAGTAAATTAGTAAAGTAATGTAGT
SQ  GGCAAAGACGTAACTAAATTGAAAAGTTTGACCATCGACAGGTATTGAACCGGACCAGTT
SQ  AATGGGAGACGTTCTATACTACGGAGGACAACCACTCTGCGGTGGTGCAGCTTGCACGGC
SQ  CGACCTGACGTGGGAAAAGCTGATCGACGAGTAATCGCACTGGAGGCAAGCTGATCGTGC
SQ  TTGACGTTGAGCTAAAACATTGTGGTCCTTGCGTTAAAGTGTATCCGACCGGGCTGAAAC
SQ  TGTCCCGGTCATTGTCCGAGCACAGTCGTATTCGCTAGAATGAACGGAGACGAGAACGAT
SQ  AGTGTGTATGGAGTCACTCAAGGACATTGAATGTTATCGAAGTTCCACACTTTCTTGTTC
SQ  ATTAGAGACGGAGAGTATTCGTGTGGCGTTATGCTAGGTTCCGGTAAAGAAGAACTCATT
SQ  GGAGAGATACTTCGGTACTCAGGCGTTTCGTGTCACTTATTAATGGTGTATCAAAACTTT
SQ  AATTTTATTACATCTCACTTCAAAAAAGAATGAGTTTTTGGTCTTTGTCTGTACCATCCG
SQ  AAACCGGTTGATATGAAAGAAAAAAAAACTCAAATAGTGTGATTCTTGATTATTTGATTT
SQ  TGCTTTTGTGTTCTAACTTTGAAGGCACGGAAACTTTGACGGATTTGAATATTTCCGTAA
SQ  GGAAGAATGAGATGTTAATGATTTGTACCTACCCAATGAAGATATTGTATTATTCCCAAT
SQ  AAATATATACACATTATCATCATTTTGTATGTGATATTAATGGTTGATTGTGATTTACAT
SQ  TTATATATGCCAACAATTTGGGTGGTGGAAAGACATTGGTTGTTGTCATACTCTCTGTCA
SQ  CAGAAGGAAATACAAAAACTAATTTGTAATTGTAACTGTAAATATGTAGCGAGAAAGAGT
SQ  TTTTTTTTTTTTTTTTTGGACGGAGCAAAATTGATATTCACAAAAGACTATTGAAGTGAA
SQ  CGATCATCATCCATCATCACAATATATCACATATATACACAAAACAAGAAAATCCAGACT
SQ  CATTGTGAATGATGATCATTATACAATTTGAACTGCAGTAATTGATATAGTATACTGAAA
SQ  GAAAGAAATTTAATCAAATGGTTTGAAGATGAAGTGGTTTTGGTGGATCCAATGGGTCCT
SQ  T
SC  EMBL #Z83321; nt 14341-15781
XX
FT  216 - 223: MRS: small half site motif (8/8) [2]
FT  279 - 299: MAR-specific signature [1]
FT  288 - 303: MRS: large half site motif (16/16) [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z83321; ATZ83321
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//