S/MARt DB - S/MAR

AC  SM0000056
XX
DT  1.1.1999 00:00:00 (created); ili
DT  17.12.1999 11:03:22 (updated); ili
XX
NA  AT$ATH1-5MAR2
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  1717 bp
XX
LO  4
DE  G001342; Arabidopsis thaliana homeobox 1 gene
DP  Direction: 5'; 7343 - 5627; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  homeobox protein ATH1 is suspected to be a transcription
DC  factor

G001342;
Arabidopsis thaliana homeobox 1 gene

XX
SQ  GGATCTTTTTTTTTTTGCGGTTTGCACGATGCTAATAAGAGTGGGTGTGCTACACTCTGC
SQ  AATTCCTCTGTTTCTGAAACATCTTTTCCAGAGTGAACACAAAAGAAGAAACCAAAAAGC
SQ  TCTTTATTGCACGTGTTTTCTTCTCAACAAAACTCATAATCTTTCTTTTTAATTGGGTTG
SQ  CCTGAATTTTCAGCCCGTATACTCGTCCGAATCTCAACTTTCCACCCTAAACTTTTAGCC
SQ  ACTTGAAAAACCTCCATAAACAATTTTAATCTCGATAAAACTACATGTACTTTCGGATTT
SQ  GTTCTTTTGAGTACGCCTCCAATTGAACCGACCAGTTAACCGATAATTATACATCCGATT
SQ  TGATTTACCCCTAATTTAACCGAAACTAATCTGATTTTGACTCTATTTTAGCCTAATTTT
SQ  GACCCACACAAAATGTAAATAAATTGTCTTATTAAGAAGTAAAAGTATTTTTATTAATTT
SQ  GTATTTGTGATAAACAATTAAAAATATTAAATTATTACTTAATTTTAGCAAAACTTAATA
SQ  TGACAAAATATACCCCAAATTATATTTTGAGCTACATTTTGTTATAAAATTTTGATAATA
SQ  TACAAACATATACATTTTCCTTTTGGCAATCATTTATATTTTTTTATAAATTTAAAGCTA
SQ  TGTCTTTTTTTAAACAAAAATATTCATTTTTCTTGAAATCATAATATATGACCTTTGAAC
SQ  TCTATATATGTAATAAAATTCAAAATATATGCCAAATTTATTTTTATAGATATCCATAAA
SQ  CACCACAATCAAAGTATATCTTATGGTATTTATAAATTTATTTTTCTTTATAGATTCAGT
SQ  TTTCTTTTTATATATTCAAGATGAGTTATATATGTATATATATATATATATATTTATATA
SQ  TGATTATGGTGTTTTTAAAAAGAAAATGGCTTTTGAATTATTAAATTTAGAGTATATACC
SQ  AAATACATTTATATATATAACACCATTGTATTTATAAAAAGAATTTGTTGTCTATTTTGT
SQ  TATATTATTTTGCGGTATATTTTGTTATTTTATTATTTTGGTAAAATTAATTAATTTATT
SQ  TTTAATTTTTTATCAAAAATAATAAAAATAAATAAAAAGTATTTTTCTTCTAGAGAATAT
SQ  ATTTTTTGGGTATAAATTGGGTTAAAATAGAGTCAAAATCGGATTAGTTTTGGATAAATT
SQ  ATTGGTAAGTCAAACCGGATGTATAATTATCGGTTCACTGGTCGGTTCAGTTGGAGGCGT
SQ  AGATCTGAGAACACATCCGAAAGTACATGTAGTTTTATCGAGATTAAAATTGTTTATGGT
SQ  GGTTTTTCAAGTGGCTAAAAATATAGGGTGGAATGTTAGTATAGGGCTGAAAATTCAGGC
SQ  GACCCTTTTTAATTTAAATAGAGATATCCTTTCTGTAGTTTTTGACAAGCAAAGCTGCAT
SQ  CTCTGTGTATACTAAAGGAAAATCTAACTAAGAGGACACATTCCTCCTACTTAAACAATG
SQ  AAATAGAAATTCTAACTAAGTTAGAAACCAACAAATTAAAAGAATATGTATCCGTCTGGT
SQ  CATGGCTCCGAGGCAAGTTTCCAAATTTTAACCATTTTATCGTCGCTGGCCGAGGCAAGC
SQ  AACCGGCTTTCCTTCTGCAATGCAAATCTCGATTTCAGAATCTTTAGCAAGAGATGATTC
SQ  GCCGTATATGCTAAAACTAGTTTAAACAAGGAAATCA
SC  EMBL #Z83320; nt 2046-3762, release 52
XX
FT  753 - 768: MAR-specific signature [1]
FT  1042 - 1049: MRS: small half site motif (8/8), overlapping
FT                 the large half site [2]
FT  1044 - 1059: MRS: large half site motif (15/16) [2]
FT  1098 - 1105: MRS: small half site motif (8/8) [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z83320; ATZ83320
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//