S/MARt DB - S/MAR

AC  SM0000057
XX
DT  1.1.1999 00:00:00 (created); ili
DT  16.12.1999 17:31:13 (updated); ili
XX
NA  AT$ATH1-5MAR1
XX
OS  thale cress, Arabidopsis thaliana
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; dilleniidae; capparales; brassicaceae
XX
SZ  1099 bp
XX
LO  4
DE  G001342; Arabidopsis thaliana homeobox 1 gene
DP  Direction: 5'; 1484 - 286; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  locates to a Hind III/Hind III fragment [1]

G001342;
Arabidopsis thaliana homeobox 1 gene

XX
SQ  AAGCTTACGTAAAAAACTTATATGAAAAAAATACGTAAATGGATATAAGATTTGATGGCA
SQ  CAATACAAAGACACGAGTGGTGAGAAAAGAAAGAAGAAAAAGCAAGAACCCAAATGGATC
SQ  ACACATCTCATCAATTCTCCTTAAATGGCTAAAAAAGATCTCACCCTTCTTTACTTTTTT
SQ  CCCTCTTTCTGATTTGTGATAATTGAAACCAGCACAAGAAGACAACACCATTTTCTTATA
SQ  ACTTTATAAAATTTTATAAATAGAGACACATACATATATATATATATAGAGACATGTAAA
SQ  TAGTAAAATGTAGGGTCTCTTCCCTAATTTAAAGCCTGCAACAGAAATGAGTGCACTTCT
SQ  CTGTAGTAAACAGTAACACATCGGTCTTCTTCATGTCTTTGGATTTCTTTTTTGGATTTC
SQ  GATTCTGTTTCAACCATATATTTTCTTTAGATAATTTTACTAGATTCATCTCTTTCTCTA
SQ  TGAACAACATTTTAAATAAATGACATTTTAAGAAAGTGATTATATATAAGATTTTCTTGA
SQ  TTCTGATTTATCTTTTTTTTTGGTCGGAAGATCTTAAAGATATGAAAATGGATTCGTGTC
SQ  ATAAACAGAGGCAGCTCCGTACGTGATTTGGCCCTCCTTCTTTTCAACTTCTTCTTTCTT
SQ  GAATATTAAAGTTGTATTTTTCCCCTCGATAATACAACTTTTGGTTTGTTTATTTAGTTA
SQ  TAAAATGTTGCTATTTGTTGATCTAGTGCTCTGAATCTTTTAGTGAGGCAGATGATGAAG
SQ  ATTATGAATTTCTTCATGAAATTATTGTAAGAAAAAGTAAGTAATTTTTTTTGTAAGTGT
SQ  TTGCGTTCATGCAAAAGAGATTAATCAGACCCACTTTTCTCTTTTTCAGTTTTGTTGCAT
SQ  TATTTTGTTCTCTTTAATTTATGAATACTAACTTTATTGTTGATTTCTGCTTTTTGGTTC
SQ  TCTTTAGGAACATAGAGAAGCTGCGGAATGAAAGTACACTGTTCTTTCACGGAGAAAGAA
SQ  GATAAATAAGCATTATCTTTCTTCTTCAGTTTTTAACACACATTTTGGAAATTTTGATGT
SQ  AAAAATTCTCTTTGGAACG
SC  EMBL #Z83320; nt 7905-9103, release 52
XX
SF  caution: mentioned to contain a MAR-specific signature as
SF  well as a MAR-recognition sequence (MRS) which are not
SF  present in the given sequence therefore the sequence might
SF  be incomplete [1] [2]
XX
EV  in vitro selection of S/MAR [1]
EC  rat liver matrix
XX
DR  EMBL: Z83320; ATZ83320
XX
RN  [1]
RX  MEDLINE; 98026209 PubMed; 9380515
RA  van Drunen, C. M., Oosterling, R. W., Keultjes, G. M.,
RA  Weisbeek, P. J., van Driel, R., Smeekens, S. C.
RT  Analysis of the chromatin domain organisation around the
RT  plastocyanin gene reveals an MAR-specific sequence element
RT  in Arabidopsis thaliana
RL  Nucleic Acids Res. 25:3904-3911 (1997)
RN  [2]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//