S/MARt DB - S/MAR

AC  SM0000058
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 11:26:00 (updated); ili
XX
NA  PEA$PC-3MAR
XX
OS  pea, Pisum sativum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; rosidae; fabales; fabaceae
XX
SZ  1380 bp
XX
DE  G001303; plastocyanin
DP  Direction: 3'
DN  Internal: n; Gene position numeral: -1
DC  located about 8 kb downstream [1]; PC is a single-copy
DC  gene in pea [1]

G001303;
plastocyanin

XX
SQ  GGATCCTCTAACACTTTTCGTCGATCTCTGATTGGGCGAGTGTTGAAACTGAGAATATGT
SQ  CGTGTCCTACTGCTTTTTCCTCGCTAAGAGGGAACCAAGAGACCGATCCTTTCAGAGTGT
SQ  ATCTGATTGTTGGGTTGTCGAGAACATGTACTTCAACAGCTATGTCGATCATCGTTAGAC
SQ  GCGGCCATTTGACGAGATGATGTTATACTTTGGATGATTGGCCTACGGATCATGTCTCAC
SQ  TGCTCCCCATCTGTCTGAGCGCGTCATGCGGCAGTTTGGCTACACTCAGACCATTTCCAG
SQ  ACACCCTGTTGTCTTTGCTCTTCTTGCTTTAACACGTAAGATAAATGACATTTTTTATGA
SQ  TTATGAGAGTCATCTGGTATCAGAGGAGGCCCAGAGTATCATAGTTGTGAACGATTGGAG
SQ  CTACATCGAAGGGTATATCAGAATGTTCTTAAGGGTGTCACATCCGTACATGGTGCACGT
SQ  TGCTCCAGAGACCACCTAGGCCAACTCATCGGGAGATACTAGAGGAGAAGCATGCACAAC
SQ  TAAATTATGTTGAGGATGTCTTGCCTATATGTCGTCGCATTGTGGAGATTGCGTAGATAG
SQ  ACATTGACAAATGTATCTTGCTGATCTGGCTGATGTGAGACATGTCCTAAATGCCATCAT
SQ  GACGTAGGCACATGGGACATTGATGTACCGGAGACAACGTCGGAGGACGGGGGATTGATG
SQ  GCCTACGAGACATAACTGACAGAGGAGGCAGAGGCGATGTAGTTAGACATACACATTAGT
SQ  GCATTAATATATAATAGTAGTAGTGTCATGGATTTTATTTTATTTTGACATTATACTACT
SQ  CTATCGTTGTTTTTGACTTTTTTTGACACTTCTTGATCTTTTATTTATAACATTTTTGGA
SQ  CCATCTAAATTTATGTACGTCATTTTTTGCACATTGCTTGTAAGGTTTAAATCTTCATCT
SQ  GAGCAAACATAAACAAAATATAGCATGAACAATTCTATTATGATAAATTACGAAAATATA
SQ  TCTCCGTAAAAATAAACGAAGATGCATCTCCATAATATTTTAAATTATAAAATGACCTAT
SQ  GAATGTGATCTATAATATACATTTTAAATTGTTACGAAAATACGTCTCTAAAATATTTTA
SQ  AAATTTAATTAGAATTTGATACGTCACTAAAATATTTTAAAATTTAATTAGAATTTGATA
SQ  CGTCAGAATATGTATCTCAAAATCGTATGATTAATTATGTATTTTTATATGATGGATAAG
SQ  AAATCTATAAAATATATTAAAAAGTTTCCTAATCATAAATGTGTACATGAACATGTGAGG
SQ  CATGGAAGCCTCCATTGGTAGTACATTAACATGTGAGGCATGGAAGCCTCCATTGGTAGG
SC  EMBL #M77843
XX
FT  353 - 363(EMBL): ARS sequence similarity [1]
FT  687 - 916(EMBL): fragment containing not only the end of the
FT                   SAR but also the end of the plastocyanin
FT                   downstream repeat [1]
FT  780 - 794(EMBL): similaity to topoisomerase II site [1]
FT  815 - 824(EMBL): T-box [1]
FT  1290 - 1300(EMBL): ARS sequence similarity [1]
XX
FF  rather weak matrix binding [2]; SAR is closely linked
FF  to a repeat sequence, which may be present 300 times per
FF  haploid geneome [1]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: M77843; PSCHSAR
XX
RN  [1]
RX  MEDLINE; 92338843 PubMed; 1821767
RA  Slatter, R. E., Dupree, P., Gray, J. C.
RT  A scaffold-associated DNA region is located downstream of
RT  the pea plastocyanin gene
RL  Plant Cell 3:1239-1250 (1991)
RN  [2]
RA  Minami, M., Morisawa, G., Hayashi, M., Sakata, Y., Habu,
RA  Y., Iwabuchi, M., Meshi, T.
RT  High affinity of the 5'-upstream region of a winged bean
RT  chymotrypsin inhibitor gene for nuclear matrix
RL  Plant Cell Physiol. 40:109-113 (1999)
//