S/MARt DB - S/MAR

AC  SM0000060
XX
DT  8.6.1999 17:03:18 (created); ili
DT  28.5.2002 15:34:00 (updated); ili
XX
NA  HS$PRM-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  951 bp
XX
LO  16p13.13
DE  G001340; open reading frame
DN  Internal: n; Gene position numeral: -2
DC  most possibly a pseudogene that locates between TNP2 and
DC  PRM2 and named gene4 in [3]
DE  G001445; protamin 1
DP  Direction: 3'; 17554 - 18504; Pos 1: ATG
DN  Internal: n; Gene position numeral: -4
DE  G001446; protamine 2
DP  Direction: 3'; 12693 - 13643; Pos 1: ATG
DN  Internal: n; Gene position numeral: -3
DE  G001447; transition protein 2
DP  Direction: 3'; 5597 - 6547; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G001503; suppressor of cytokine signaling 1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DE  G001504; 
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 2

G001445;
protamin 1
G001446;
protamine 2
G001340;
open reading frame
G001447;
transition protein 2
G001503;
suppressor of cytokine signaling 1
G001504;

XX
SQ  CAAGGGGAAATGCAGTGGTCCTGGGTTGGGGCAGGAGTCGGGAATGGAGTGGGTCAGATG
SQ  AGAGGGCAGACCCTGGTGGAGATGCCCATGTGAGCTATGATTCGAAAGGAAAAACATCTC
SQ  AAACCCTGCAGCCACACAGACCCAGCTTCAAATCCCAGCTCTCCCATTCCCTCGCTGGGT
SQ  GACCCCAGGACGATTCCTTAATCTCTCTGAGTCTCAGGTGCGTCTCACACTTTGTAAAGA
SQ  GAACCGAGGAGGCCATGCTGTTCACTGCTGCATCTCCGGGACTTAGCACAGTGCCTGGCA
SQ  CATATTAGGAGTGCAGTAAGTATTTGTTGAATAAATGAAAGAAGAAGCAGGCATTAAAGC
SQ  AACAATGAGAAGCCACCACTTACCAAATCATCAAATAGGCAAAAATGGAAAAAGTAAGAT
SQ  AATGGTGAAGGCATGGGGAAACATTGTTGAATGCTTTTGCCCAGAAGGTAAATGTGCACA
SQ  GCACGCTGGCAGGTGACTGGGTGGCACCTATGAACATTCAAACGGTAAGAACGGTTTATC
SQ  ACATGTGTGCCAAGAGGCTGTACAGGGAGGTGCAGGCCACGCTGTTTGCAAGAGCAAAAA
SQ  TACAACCTATGTGTCCACCCACCGGGACGGCTAAATGAACATACGCTGAGGAGTATCATG
SQ  CAGTTCTTAAGGAGCATGGGGTCGATCTATATGTGATCTAGCCAGATTGCCAGAGTATCT
SQ  GTTGGGTGGAAAGTGCAAGATGGAGAAAGACATGACATTGATAGAGGGAAAAGTCCTACA
SQ  CAAAGGAATACTATTTTTTTTTTTAAATAATTGGGGTCTTGCTCTGTCACCTCGGCTGGA
SQ  GTGCAGTGGCACAATCATAGCTCACCACAGCCTCGAACTGACCACAAGTGATCCTCCCAG
SQ  CTCGACCTCCCAAAGCGCTAGGATTACAGGCATGAGCCACCACACCTGGCC
SC  EMBL #U15422; nt 32586-33536
XX
SF  contains Alu repeat [4]; methylated [4]
XX
CH  seems to act as boundary element [1]
XX
FF  sperm specific [1]; small mutation in this region may
FF  affect protamine expression and thereby lead to infertil
FF  sperm [2]; association with sperm nuclear matrix is
FF  independent of Alu methylation [4]
XX
CP  sperm [1]
CN  HeLa [1]
XX
EV  in vivo selection/high salt [1]
XX
DR  EMBL: U15422; HS15422
XX
RN  [1]
RX  MEDLINE; 96216068 PubMed; 8662749
RA  Kramer, J. A., Krawetz, S. A.
RT  Nuclear matrix interactions within the sperm genome
RL  J. Biol. Chem. 271:11619-11622 (1996)
RN  [2]
RX  MEDLINE; 99393902 PubMed; 10464636
RA  Kramer, J. A., Zhang, S., Yaron, Y., Zhao, Y., Krawetz, S.
RA  A.
RT  Genetic testing for male infertility: a postulated role for
RT  mutations in sperm nuclear matrix attachment regions
RL  Genetic Testing 1:125-129 (1997)
RN  [3]
RX  MEDLINE; 98390623 PubMed; 9723181
RA  Kramer, J. A., Adams, M. A., Singh, G. B., Dogget, N. A.,
RA  Krawetz, S. A.
RT  Extended analysis of the region encompassing the
RT  PRM1->PRM2->TNP2 domain: genomic organization, evolution
RT  and gene identification
RL  J. Exp. Zool. 282:245-253 (1998)
RN  [4]
RX  MEDLINE; 21458905 PubMed; 11574659
RA  Schmid, C., Heng, H. H. Q., Rubin, C., Ye, C.J., Krawetz,
RA  S. A.
RT  Sperm nuclear matrix association of the PRM1-->PRM2-->TNP2
RT  domain is independent of Alu methylation
RL  Mol. Hum. Reprod. 7:903-911 (2001)
//