S/MARt DB - S/MAR

AC  SM0000062
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  NT$H83-MAR
XX
OS  tobacco, Nicotiana tabacum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  1738 bp
XX
LO  T9/t3, telomeric
XX
SQ  AGGCCTAATTAGTAAAAGAAGAATTTACCTAAATAGTCGCTCATTTAGTAGAGCTGGCAG
SQ  ATGTATAATATATGTAAAATTCATATATAAAATGAGTATAAAGAAGGCAAAAATATATAA
SQ  AGACCCCATTAAACTTGTTCGAAGTGAATTAAATGCTACCCTAAAGGCTTATATGAAAGA
SQ  AAAGGAAAAAAAAAAAAAAAAGAGCGTAAAATTTTTTAAAAAATGGGCCCGCTGATAATA
SQ  TGTAATAAAATAAAAATAAAAAATAAAATTGGGCTCCTCTCATTTTTTTAACCTACCACC
SQ  TGCCTTCTTTCTCCTTCTTCTAACCCCCCCCCCCCCCTCTATTCGCCCAGCTATTCATCT
SQ  TCTTCCTTTCCCACTATCTGCTCGATCTTTTTTCTTTTAATTTTTTTCTTTCTCGCCATC
SQ  TGCCTCATCTTCTTTCTTTTTCTTTTTTATTCAGTCCCAACATATTAAGAACATGATAAT
SQ  GAAATTTTCTTTGTTCTAAAAATTAAGAAATTAATATAGCATCTTTTCGTATTTTCTCTG
SQ  TTGCGGTTAATTAAATAAGAAAAAATCATAGTGGATGTTGAAGATTGAAATAAAAAATTA
SQ  AAAATAATTAATATGATAAGATAACGAAACAAAAAAAGAGGAGAGTAAACCAAGATCGAA
SQ  GGGATTTAAATTTGTAGGATATACGGATGAGAATTCGATGAAAAAATATAATTAAGAGGA
SQ  ATTTATTAATTAATTAGAGATTTATTAGTGTATTAAATAAAGAGCAAGGAAAAAAATATG
SQ  ATAGACAAAAAAGAAACGAAAAGGTTAAAAAAATTAAAATTTAGATAATTTCTGATGTGG
SQ  CTCTAACGTGGTGCTGATATGGCTCTGATATGGCAATGATGTGGCGCGTGTGTAAAGCAC
SQ  ATCACATTGTGAGGTTGGTATTATGTGTTAGGGTAGCATTTAATTCACTCCGAACAAGAA
SQ  TAGGGGTAAAAGACACCCGTTTAATTAAGAGTTTAAACCTATTTTTTGAACAAGTTTAAT
SQ  GGGGTCTTTATGTATTTTGCCTGTAGAGACGGATCCCAGGACTTTTATAAGGTTCAAATA
SQ  AGTTCCCAACATGACTGTTGTAGTCACAGTCATTTCATGGGAGCTAGTAGTTACACATAA
SQ  GAGAAGGGGGGAAAAGGCAAGTGTGCAATTGAATATTTGAAACATGTCGTTTATGATTGA
SQ  CGTACAACGGAGTTTTTAAATGATTTTTAAATGATCAAGATGATGCAAATGATATGTATA
SQ  TAATTAGCGTATAATTTATATTAATTTTCTAGAAGGTCAAATGAAGCTATGTGGGCGGGC
SQ  CTGATTAAAGTTTTCATTTCATGAATAACCTATACAAATTTCACTAATTATTTTCACTCT
SQ  AAACCAAATTGTCAAAATGCAATCTATTGCTACCTTAATTTCATTTTAGTTGAAATTGGA
SQ  TATACTTTCACTTTCATTATTTATATAACCGTGTCCAAATCAAATGACACCGCATGTGGC
SQ  TAAAAACTCATAAGTTCTTTTTTCATCATTTACTTTTGAAAAATTAACCCAAAATGTTGC
SQ  TCACCTAACCGCTTAAACTAAAAATAGCCGGTGGAGGTATAATATATACATAATTAATGT
SQ  ATTATATATGTATAATTGTGTATAATCAATATATAAACTATGTATATAGCTAGAAAAAGT
SQ  AAATAATCAATATGGCCGGCTAGTTGTGTAAAGATCCCTTTACTTTTCTCCACTGACG
SC  EMBL #Y12533
XX
FT  7 - 291(EMBL): AT-rich region [1]
FT  387 - 823(EMBL): AT-rich region [1]
FT  1501 - 1739(EMBL): AT-rich region [1]
FT  1739 - 1739(EMBL): T-DNA integration site
XX
FF  identified in an analysis of sequences surrounding stably
FF  integrated T-DNA [1]; an ORF encoding a polypeptide with
FF  similarity to the integrase region of several retroelements
FF  may be found in the vicinity of this MAR [1]
XX
EV  in vitro selection of S/MAR [1]
EC  tobacco matrix
XX
DR  EMBL: Y12533; NTDNAH83
XX
RN  [1]
RX  MEDLINE; 97432140 PubMed; 9286104
RA  Iglesias, V. A., Moscone, E. A., Papp, I., Neuhuber, F.,
RA  Michalowski, S., Phelan, T., Spiker, S., Matzke, M.,
RA  Matzke, A. J. M.
RT  Molecular and cytogenetic analyses of stably and unstably
RT  expressed transgene loci in tobacco
RL  Plant Cell 9:1251-1264 (1997)
//