S/MARt DB - S/MAR

AC  SM0000063
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:20:00 (updated); ili
XX
NA  RICE$Sh2-5MAR
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1172 bp
XX
DE  G001347; ADP-glucose pyrophosphorylase large subunit
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001347;
ADP-glucose pyrophosphorylase large subunit

XX
SQ  GAGCTCTGAAACCAGCTTACCACCGTTAGTTCCAGCTCGGTTTTCTTTTTTTCCCCTTAA
SQ  AGGTTTCATGCGTATCGTGACAGATGTTACATAATGACAAATTCCCCAGCTGGAGCACCT
SQ  TTATCCCTGCTGTTTGCATGAAATTAGCTTGTCTTGTAGTTCCCTCCAGCAAAAAGAAGT
SQ  CTGAAACAAAACAACATTTCGAAAAAAAGGCATCCATGAGTTAGCATTTCTACAGTTGTC
SQ  TATAGAGGGGAAGGCTGCACGACAAAGTTTCCAGGCTTGGAAACAACCTCTTATGTAAAA
SQ  TTTTTCGTATGTATCAGATGATTTGTTTGCGTTACGGCATCTCCACCTAACATCACCTTC
SQ  ATCATGCGCCTATGGTCTTTCTCTTGCCTGTTTTATACGTAAAATTGGAAACGACAGAAA
SQ  CTTTTGCCATCTTTATTAAAGGAAGGCAAATATGCAAATATAGGCATCAAGATCACAGTT
SQ  AGTGGATTATCATCTTTGTAGGTTAACATGTCCTACCCCAGGGGAGCTTATACTCAAGTA
SQ  CTCCATGCATTTTCATGAAATGAGAAAAAACGATTTTTAAGAGAAATGTACTTTCTTGTA
SQ  TTTATGCCAAATGGCAAGGACTGAAAGGGAAAAACTAAGAAAGGGAACGTTACAGTAAGG
SQ  CTCTGTGGGGACTGGGGACTTCAGAGAAACGTGAACCCTGCTTCCTTCCTCTGCATGAAC
SQ  ATAACACCAGAGGTTTCCAGCCTTTCACACAGTTGTTGATGGCTTCACACAATTCATCTC
SQ  TACCTCCTGACTCTTTATAAGGACCCCCAGCATCACCACAATTGCACAAGTACAGGCATT
SQ  AGATCCACAAGAACACTTGGGCAGGCAAGCACCTCTTTGATCTTTAAGCCGTTGTTATGT
SQ  TCTATTTCTGAGCATATGGTTTCTAGTTATATTCTTTTTCTTCATTCGTTTCATATCTTT
SQ  GAAGTGTTGATGCAAATGCAGTGAACAACTATCAACTGTGTACTCTCCAAGTGAATGCGA
SQ  ATAATCATTTCCTGTGAGAATTGTGGGCTAGATAAACGAACGAAATGCTGTTTTATCTAT
SQ  GTCATGTGTGGAAATTTAGTTAATTTTCCGGTCTTTTTATGCATTGAGATGGGTATGCTG
SQ  TTTTTTTAGTTGGGTCCCATCATCTTGAGAAT
SC  EMBL #U70541; nt 1-1173
XX
FT  338 - 362(EMBL): A/T/C stretch of 25 nt [1]
FT  763 - 787(EMBL): A/T/C stretch of 25 nt [1]
XX
FF  weak MAR as judged by band intensity in binding assay [1]
XX
EV  in vitro selection of S/MAR [1]
EC  rice leaf matrices
XX
DR  EMBL: U70541; OSU70541
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
//