S/MARt DB - S/MAR

AC  SM0000064
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:27:00 (updated); ili
XX
NA  RICE$Sh2-3MAR
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  2025 bp
XX
DE  G001340; open reading frame
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  originally named gene X, located between Sh2 and A1a gene
DC  [1]; supposed to code for a transcription factor due to
DC  the presence of  putative protein-protein interaction and
DC  zinc finger domains [1] [2]
DE  G001347; ADP-glucose pyrophosphorylase large subunit
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G001347;
ADP-glucose pyrophosphorylase large subunit
G001340;
open reading frame

XX
SQ  GTTAGCATCGGGTGTGAACTCAAGGTACTTTATCAAGACATAAAGCTCATAGTTTGGACA
SQ  TTCAATGCATCAAAATTTGATGTCTTATTAAGATTAGATTGATTCATAGGTACTGTTTGG
SQ  AAACTACCAATTATTCTCATGTAGTTTTGCAATTCTAAAATTCACAGGATACCATGATGA
SQ  TGGGTGCAGATCAATATGAAACTGAAGAAGAAACTTCAAAGCTATTGTTTGAAGGCAAGG
SQ  TCCCAATTGGTATAGGCGAGAACACAAAGATAAGGTGAGCCACATCTGGACTAATGCTTA
SQ  CATATTACTGTCCTTACCTGGCAATATCGTGTTTCCAAATGTATGAGACCTTCGTTTCAT
SQ  GAATTTTAGGAACTGTATCATCGACATGAATGCTAGAATTGGCAGGAACGTGATCATTGC
SQ  AAACACTCAGGTGAGCAAGTATATGTATTTAACTACTCCAAAGTCGATGAACTCATCTTT
SQ  TATAAACACTTGGTAACCACACGAGTTCACTGCGTATGATAGGGGGTCCAAGAGTCTGAT
SQ  CACCCTGAAGAGGGATACTACATAAGGTCTGGAATTGTGGTGATCCTGAAGAATGCAACC
SQ  ATCAAGGACGGGACCGTCATATAAAAGCATAGATAGGCCTTGGAATCGCACCTCCAGTCA
SQ  TCTGAAAACTGGCATCCATTGATGTGGGATTTTGATGCATGAGTTGGATTCAAGACGGAT
SQ  AGCGTAGCCTCCATGGCGAAGTGGTGTTTTTGGTTTAGCTATATGCCTATATGCAATAAG
SQ  CTGCCTGAGGAAGTCGCGCAACCTTTTGTGTAATTTCAGGTTTATGTACTTGGTTTGTTT
SQ  TGGAATGGGAACTCTATTATTGGTATTCTGAAGTTTGCACCTCTCTCTCAGCAGACTTGT
SQ  CCTGTAATTTGCTTCGCTTGTTTGATGTGTCTTCGGTTTTTTAATTCTCACCTCCTTGCA
SQ  ACATATGAGACAGAAGAGCTTATGGGGGAAGTAAACAGCTGTAAGGAAATGAAGAGCGTG
SQ  TGCAATTGGTTTGCTCTTGCTCGGCAGGTAAGATCAGAGCCAATCGCTGCCATCGGTTGG
SQ  TATAATGCTGATTATAAGCAACAATGTAATTTATAGTTAAAACTTTTATTTACGTGTACC
SQ  TAACGATGTGTAATTCAATACTGACAAATAAACTTTGATAAGAAAAATACAAAATCATCT
SQ  TTGAAATTATGTTTTAGAAAATCATATTTAATGAAGGCTGCATTTGAAGGTAGAGGTTGG
SQ  GAACCTCACATTTTTGCACACAAAACGGAATGATCAATTAGCGCATGATTAATTAAGAGT
SQ  TTACTAAAATAAACTTGAAAAATTGATTAATATGATTTTTTAAAGTAGACATATCATTTA
SQ  GCAGAATTAGCTAAAATAAACTTGAAAAATTGATTAATATAATTTTTTGAAGGTAGCTAG
SQ  ATTTTTTTTTAAAAAAATACTCTCTGTAAAAAAAGCTAATCTAGTAGGGGATGTGACCCC
SQ  TCCTAGTATTACAAATCTGGGCAATGGACTGTCTGTCCAGATTTATTGTATTAAGAGGGA
SQ  CATTGTTCAGATTCGTCCTAGGTGTTTTTTTTTTTGGGATGGATGGAGTACATCCTAGTG
SQ  AAAAAATAAGAGAATGGAGGTACTCCCTCCGTTTCACAATGTAATATTTTCTAGCATTGT
SQ  TCACGTACATATAGATATTAATGAATCTAAATACATATATATGTCTAGATTCATTAACAT
SQ  CTAAATAAATATGGATAATGCTAGAAAGTGTTACATTGTGATTGTGAAATGGAGGACGTG
SQ  GAACCTTCCGTGCCGAACATAACCCTATATGTTCAGCTGCAGCATGCTCGTGGTGGTGGC
SQ  TGTGTCACTCGACCTGTAGCATGCGAAGTGGACGAGGAGAGAGGGAAAGGAGATGGGCCC
SQ  TCGTCTCACGAGCGCAGACAGCCGTTCACTCTTAAATAAACGGTGTAGATTTCAGCTAAT
SQ  GCACGAAATTGCTCGTCTGCGGTAGCAATAGCTATGGCAGCGGAT
SC  EMBL #U70541; nt 5400-7425
XX
FT  5532 - 5549(EMBL): putative site for murine topoisomerase II
FT                     [1]
FT  6479 - 6651(EMBL): miniature inverted repeat transposable
FT                     element [1]
FT  6840 - 6864(EMBL): A/T/C stretch of 25 nt [1]
FT  6984 - 6993(EMBL): T box (TTWTWTTWTT) [1]
FT  7042 - 7191(EMBL): miniature inverted repeat transposable
FT                     element [1]
FT  7062 - 7067(EMBL): BUR (AATATT) [1]
XX
FF  strong MAR as judged by band intensity in binding assay
FF  [1]
XX
EV  in vitro selection of S/MAR [1]
EC  rice leaf matrices
XX
DR  EMBL: U70541; OSU70541
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
RN  [2]
RX  MEDLINE; 98133900 PubMed; 9475753
RA  Chen, M., SanMiguel, P., Bennetzen, J. L.
RT  Sequence organization and conservation in sh2/a1-homologous
RT  regions of sorghum and rice
RL  Genetics 148:435-443 (1998)
//