S/MARt DB - S/MAR

AC  SM0000065
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:29:00 (updated); ili
XX
NA  RICE$A1-5MAR2
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1160 bp
XX
DE  G001340; open reading frame
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  most adjacent S/MAR downstream of an ORF, originally named
DC  gene X [1]; this ORF is located between Sh2 and A1 gene;
DC  supposed to code for a transcription factor due to the
DC  precence of  putative protein-protein interaction and zinc
DC  finger domains [1] [2]
DE  G001346; NADPH-dependent reductase A1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  most 5' located S/MAR in the region upstream the rice A1
DC  gene [1]

G001340;
open reading frame
G001346;
NADPH-dependent reductase A1

XX
SQ  ATTCTGCAAAAAAAAAAATGTTTTTGAAAGTTACACGATTTCGCTGAATCTGAACATTTT
SQ  TTTTTGCCTCGTCAGCCAAACCGACCAATCTATCTATCTACCTATCTATTATTCTATTAT
SQ  ATTATTAAAACAGCTTTGAAAGGAGGCACCACGTTCGCTGTGGGGGCTAGAAATTCTCAC
SQ  ATTAATCGGAGAAAAAGAAAAGAAGAGTCCATGTAGAAATACAATTCAAAAATAGCTGAA
SQ  ATTCGGAATTAAAAATAAACACTATCGAAAGAAGTTTCCATATAAGAACTCAATACGAGA
SQ  TTAATCGAAATTCGAAATAAAAATAAAAAAAATCCGAAATTAGAAAATTAAAGGAGAGTC
SQ  CAAGTAGGAATATAATTTAAAAATAACTAAATTTCAGAATTAAAAATAAGGAATACTGAG
SQ  AGAAGAGTTCATATAAGAACCCAATACGAGATTAGTTAATATTCGGAATAAAAATAAAAA
SQ  TAAAATTCAAAATTAGCAAAAAGAAAAGAAGAGTTTAAGTAGGAATATAATTTAAAATCA
SQ  ACTGAAACTCGGAATTAAAAATAAGCAATATTAAAAGAAGAATCCATATAAGAAACTAAT
SQ  ACGAGATTAATTAAAATTCAGAAAAAAAATAAAATAATATCTAAAATTAGAAAAATTAAA
SQ  AGAGAGTTCAAGTAGGAATACATTTTAAAACTCTGAAATTCAAAAAATAAAAAATAAAAA
SQ  TATTAAAAGAACACTATACAGTATTAACTAAAATTTGAAAAAAAATAAATTCTGAAATTA
SQ  AGAAAAAAGAAAAAAGATTTCAATTAGAAATATAATTTATAAATAAAAAAATTCAGGATA
SQ  AAAAATAAAGACTATTGAAAAAAAAAACCATCTATAACACATGACGAGATAAATCAAGTC
SQ  ACATGCCTATAAAAGAGTAGAGTGGTATACCAAATAGAATCCTAATGATGATTAAAAGGA
SQ  GGGACGACAGGCAGGGCCGTGAAGCAAACGAGTAAGGCGGTTGCCGGGACTTCTAGAAAG
SQ  TAAAAAAAATCCCATTGATAATCATATTCGATTTTTAAAAATCTCAATAACAATAAAAAG
SQ  GAGAAGCATCATGCAGGGTGTATAGGAGTACAGTTGCAAAGCCGCCGATGGTTGGCGGGA
SQ  CTTCTAGAAAATAAAAAATG
SC  EMBL #U70541; nt 17300-18460
XX
FT  17416 - 17425(EMBL): T box (TTWTWTTWTT) [1]
FT  17668 - 17692(EMBL): A/T/C stretch of 25 nt
FT  17757 - 17762(EMBL): BUR (AATATT) [1]
FT  17766 - 17790(EMBL): A/T/C stretch of 25 nt
FT  17866 - 17871(EMBL): BUR (AATATT) [1]
FT  17921 - 17945(EMBL): A/T/C stretch of 25 nt
FT  17995 - 18019(EMBL): A/T/C stretch of 25 nt
FT  18018 - 18023(EMBL): BUR (AATATT) [1]
FT  18107 - 18131(EMBL): A/T/C stretch of 25 nt
FT  18157 - 18181(EMBL): A/T/C stretch of 25 nt
FT  18350 - 18374(EMBL): A/T/C stretch of 25 nt
XX
EV  in vitro selection of S/MAR [1]
EC  rice leaf matrices
XX
DR  EMBL: U70541; OSU70541
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
RN  [2]
RX  MEDLINE; 98133900 PubMed; 9475753
RA  Chen, M., SanMiguel, P., Bennetzen, J. L.
RT  Sequence organization and conservation in sh2/a1-homologous
RT  regions of sorghum and rice
RL  Genetics 148:435-443 (1998)
//