S/MARt DB - S/MAR

AC  SM0000066
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:31:00 (updated); ili
XX
NA  RICE$A1-5MAR1
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  3061 bp
XX
DE  G001340; open reading frame
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  most 3' located S/MAR in the region downstream an ORF,
DC  originally named gene X [1]; ORF is located between Sh2
DC  and A1 gene; supposed to code for a transcription factor
DC  due to the precence of  putative protein-protein
DC  interaction and zinc finger domains [1] [2]
DE  G001346; NADPH-dependent reductase A1
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  this S/MAR is most adjacent to the rice A1 gene [1]

G001340;
open reading frame
G001346;
NADPH-dependent reductase A1

XX
SQ  GGATCCACCGTCTCAGGCGGGTCCTCTTCACTTACGGTTCCTGGAACGTGGTGGCAATGA
SQ  GAATTGAACCGATTGAATTAACTAGAATATAACAATTACACAACAAAAGAAAAAGAATTA
SQ  TGGAAATGAGTTCAAATGGAAGATAAAAATCAGTCGCTAAACGAATCTCAATTTGTTGAA
SQ  TGTTGTTTAATTCTCACATTAATCAGAGAAAAAGGAAAAAAATCTATTAGAAATACAATC
SQ  CAGAAGTAACTAAAATTTGAAAAAATAAATATTAAAAAAGGTCCATGTAGAATACAATAC
SQ  AATATTAATTAAAATTTGAAAAAGCAAAACCGCTAACCGTTTGACAAAACATCTAGAAAG
SQ  TAAAAAAGTGAACCCAGAAGATAATTATGTTTAATTTTTAAAATCCCAATAACTACAAAG
SQ  CGATGAGGTAGCGGATGGGCAGTAGAGGAGTATAATGAGCGTTTGACAGAGAGAATATGC
SQ  CGTTAAGCAGCACGGTCGTGACGGTTTACGGGACTTCTAAAAGTTAAAAAAAGACCAATG
SQ  ATAATCATGTTCGATTCTAAAATCTCAATGACAATAAATAGGGAGACAATGGGCAAGCCA
SQ  TAGAGCAGTACAATGACAAAGCCGCTGACGGTTTGGTGGGACTTTTAAAAAGTAAAAAAT
SQ  AAACTCAAATGATAATTATGTTTAATAATCTCAATAATAATAAAAAGAGGAGGTAGCGGA
SQ  CGGACCTTAGAGGAGTATAGTGACAGCGTTTGATGGGACTTCTAAAAATTATAAAAACGA
SQ  AATCCATCAAAACAAATAAACTCTAAAATTACGAGGTCCATTTTTTAATGGTTTCAAGGA
SQ  AAATGAATAGAAACAATGATAGATCGAGCAAGCAAATAAAAGAAGGGTCGACAAAGAAGT
SQ  AAGGGGTAGCAACTGACATAACTTTTAAAAACTATAAAATTAGAAACAAGGGGTTGCTAA
SQ  GGTTTGATTTTTTAAAATTTTAAGACAATGAGATAGCTATTTAACAAATTTTAAATAAAA
SQ  TCATAATAAAAATAGATAATTTTGTATGGGTGCTAGCGCGCAATTGCGCGGGCTACCCAG
SQ  CTAGTTATATTATTAAAACAGCTTTGAAAGGAGTCACCACTCTCGCTCGGATATCCATGA
SQ  TTAGCATATGTGATGCTACAGAAAATATTCTCTAATTATAGATTAATTAGGGTTAAAAAA
SQ  TTTGTCTCACGGATTAGATTTCATTTATGTAATTAGTTTTATAAGTAGTCTATATTTAAT
SQ  ATTTTAAATTAGTATTCAAACATCCATATGACGGACTAAAGTTTACTCCTGAATCCAAAC
SQ  ACCCCCTTAGAAGTAGCACTTTCCAGACAAGATGTCAGGAGCGTATACAAATAGAGAAAG
SQ  TTTGCGTGCTTCAGAGAAAGAAACATAAAGGATAGTATATGCATAGTTGCATACAGCAAA
SQ  GCAAACAATCCAAGTAAAACTATATTAGTCTTTACTTTGGATACATATTGTCCCGTTCTA
SQ  AAATTACCACATTAATTAAAGAACAGCAATATAATCCAAGGAACTAGATCGTGGTAGGAT
SQ  CAAATTATAAGATGTATTTTCTCCATCCCAAAACAAATCAACTTTTATATACAAATCTAA
SQ  TATAGGGCATGTTTAGATCCCCAGGCAAGTTTTTTCACCCTATCACATCGAATGTTTAGA
SQ  TATATGTATGAAATATTAAATATAGAAAAAAAAACTAATTACATAGATTGCATGTAAATT
SQ  GCAAGATGAATCTTTTAAGCCTAATTGCTCTATGATTTGATAATATGGTGCTACAGTAAA
SQ  AATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCATAGGGGGATTCTGTAA
SQ  TTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATATGTGTCCGTATATCTGACGTGA
SQ  CACAGTAAAAATTTTCACCGCAGGATCTAAACACTGCCATAGACACATAGCTCCATCCCA
SQ  AAATTACCACATTAAACCAAAACAAACATAGGGACAATGTGTTTTTACCCTTGTTTTAGA
SQ  ATGTAATTGAGATTTTGCCCTTATTTTTTAGGGTTGGTGATTTTGCCCTCGCTTTTTATA
SQ  AATGAAGCTACCGTTTACCCTTGTTTTGGATGACCATGTAGGTAGGCCTAGATTAAGTGA
SQ  GTTAAAAAAAGAAGAAATTTCTAAGAAAATGTGGAAAGGACCATTATACCCTCCAAAGCA
SQ  AATAATAGCCTGGAGTCCATCCAGATCTGTCCTGCCTATTCCCCCATCGGCCAACCCAAC
SQ  CCTTAACCCGAGCGTCGGTGTGCGGGCGAGCCAGCGGCCGGCTGCGGTTGGGCGACGGAG
SQ  TGGTAGTGGCGTAGCTGAAGCGGCGCGGGAGAGGAGCCAGGCAGCACGAGGAGCGCACGG
SQ  GCAAGCGACGGCAGCGGCGCGTTGGTGTTGCGGACATCGTCAGCGTCGGGCCGGAGGAGA
SQ  AGAAAACCCGTCGAACCTGCAAGAGCTGCTGCTGCCCTGGCTGCAAGCTGCAACTCCTGC
SQ  TGTTCCTACCAAAACCATTGTGCCATCGGCAGCTTCGGCGTCCTAGTCTTCGAGGAGGAG
SQ  GCCGAAGTAACGGCTACTTCATTGTTTGATTTTGTTGGTTTTCTTTTCTGGTTAAGCTCG
SQ  TTAATTTGGGACTGCTCCTACGCAGGTGCTCCCTCCAGTGCTCCTTACGCATTAACATTC
SQ  TCTGGTTCTTCAGAGATGGGAGGATTTAATGAGGTATTATTAAGTTTCCAAATCTGCTCT
SQ  AAAATGGCGAGCAAATTGTTTTCACATCAAACACTGATATGATTCATTCACTGTGTTGTC
SQ  TTTTTTATTAAAGAGAGAATCCCTTATATGTCACTGAAAATTGGTCTGATCCCTTATATA
SQ  CCATTGAAAATTAGCTCTTCCCTTATATGCCATTGATCTAAATTTGCACACTCTCTCATG
SQ  CCACTCCCGTCAGTTGACCGTTAATTCTTAAGGAAAAAAGACGTATTTACCCTTATGAGT
SQ  ATAGGGCATGCCTAACAACTCGGAGAGGGCAAATATGTCTTTTTTACTTGAGAGTTAACG
SQ  G
SC  EMBL #U70541; nt 20020-23080
XX
FT  20287 - 20292(EMBL): BUR (AATATT) [1]
FT  20310 - 20334(EMBL): A/T/C stretch of 25 nt
FT  20320 - 20325(EMBL): BUR (AATATT) [1]
FT  20409 - 20433(EMBL): A/T/C stretch of 25 nt
FT  20700 - 20724(EMBL): A/T/C stretch of 25 nt
FT  20799 - 20823(EMBL): A/T/C stretch of 25 nt
FT  20935 - 20959(EMBL): A/T/C stretch of 25 nt
FT  21016 - 21040(EMBL): A/T/C stretch of 25 nt
FT  21104 - 21113(EMBL): T box (TTWTWTTWTT) [1]
FT  21151 - 21345(EMBL): miniature inverted repeat transposable
FT                       element
FT  21183 - 21188(EMBL): BUR (AATATT) [1]
FT  21277 - 21282(EMBL): BUR (AATATT) [1]
FT  21515 - 21539(EMBL): A/T/C stretch of 25 nt
FT  21594 - 21618(EMBL): A/T/C stretch of 25 nt
FT  21619 - 21643(EMBL): A/T/C stretch of 25 nt
FT  21644 - 21977(EMBL): miniature inverted repeat transposable
FT                       element
FT  21711 - 21716(EMBL): BUR (AATATT) [1]
FT  21990 - 22014(EMBL): A/T/C stretch of 25 nt
XX
EV  in vitro selection of S/MAR [1]
EC  rice leaf matrices
XX
DR  EMBL: U70541; OSU70541
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
RN  [2]
RX  MEDLINE; 98133900 PubMed; 9475753
RA  Chen, M., SanMiguel, P., Bennetzen, J. L.
RT  Sequence organization and conservation in sh2/a1-homologous
RT  regions of sorghum and rice
RL  Genetics 148:435-443 (1998)
//