S/MARt DB - S/MAR

AC  SM0000067
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:32:00 (updated); ili
XX
NA  SBI$Sh2-5MAR
XX
OS  Sorghum bicolor
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1494 bp
XX
DE  G001343; ADP-glucose pyrophosphorylase large subunit
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001343;
ADP-glucose pyrophosphorylase large subunit

XX
SQ  GGATCCATTCTTTGGTACCTGTAAACCCATACAGCATAACTTGAAGATGAACAGCAGTGC
SQ  AGGGATAACTGAAGCCTAGGAGAAAATAAAAGGGATATGGACGTTTATAAGAAGCATGTA
SQ  TTCTAACAGACTACCTAATATTATTCAGATTGTGTGACATTCTATAAAAGACCCAAATGC
SQ  TTATAAAGATATATCATGTTGTAAAAATTTGATCTGCATTTCCTTTCGTAAGCAATAAAA
SQ  CAAGTCTCTTTTGGGAGTTACCATGATGAAAAAGTTAAAATATAATCTCAATAATAACTC
SQ  TGCATAGGGAAAACTTATCCTTCTGCTTATGATTAATTTTTTTTTTCTATTACAAGAACC
SQ  ACTGTAGAATGGGAAAATCACTATCTTAAATTTAAATCTACAAGAACCTGGAATAATTAG
SQ  TGCTACATTTCAATGTCTAATGAGAACAGTTTCTTTTGGACATTCCAATTCTCCTTTGAA
SQ  AATGATATATAGTTCCTGCTGTGATATAATTCATTGTATCTGTGAGTGGTACCATGGCCA
SQ  AGGAAGTAAAAAGAGATGCATAGAGGTTCTGGAATGACTTACATTTAGAGAATAGTTAAA
SQ  AAGGCTAAAACAACCAGTAGGGGGGTGGGGGGGAAAGGGGACAGAAATTTTCATGAGGGA
SQ  CCATGATTGAACTATTGAGGGTGCAAAAAATATTTTTTTTCAAATGTGGTGAAATACCTA
SQ  AGAGATGTGCACCTAGCATAGTTTTTTCTTTGGGCTCCCCTTGGCCTCTCCTTTCCTCGT
SQ  CCCCTGAAGTATCCGATTTTTTTCCTGGGGAAGGAAGGTGATCTGGGAAACGGTAATCAT
SQ  AAGAGGGAGAGCTATGCGGCATATGCCCTCAAAGGCACTTTGGCATTATCGAAGCAATAT
SQ  CGATCTCTGTTAGTTTATCTTGCGTGAACGTTTGTGGAAACTACTACCTTACAAGCATTA
SQ  GTGACAGCTCAGAAAGTTATTTCTGAAAGGTTTCATGTGTACCGTGGGAAATGTTGCCAA
SQ  CTCAAACACCTTCAATATGTTGTTTGCACGCAAATTCTTCTGGAAGAAAGGTGTCTAAAA
SQ  CTATGAGCGGGTTACAGAAAGGTACAAACCACGGCTGTGCATTTTGGAAGTATCATCTAT
SQ  AGATGTTTGTTGAGGGGAAAGCCGCACGCCAAAGTTATTTACTCAGAAACAGCTTCAACA
SQ  CACAATTGTCTGTGATATGATGGCATCTCTCACGCACCATCACCTCTCTCTCATGTCTGT
SQ  TTATTTTATTGCCCTTTCTGCTCATAAAAATCATTAAGAGTTTATAAATATGCATAGGCA
SQ  TACCAATATGCACATCTATTAATTAGCCAGAAGATCATCTTCTTATTCTTTAGTTTAGTT
SQ  ATTGTTTGAAAAATTTGTCCAGGCCTAGGGAGCTCGTGCACAGTACTAATGCATCTTCAT
SQ  CAAATGTGAATTTCAAAAAGGAAGTAGGAACCTATGAGAGTATTGTTCAAAATT
SC  EMBL #AF010283; nt 1-1495
XX
FT  1 - 514(EMBL): weak matrix binding [1]
FT  137 - 142(EMBL): BUR (AATATT) [1]
FT  275 - 299(EMBL): A/T/C stretch of 25 nt
FT  337 - 346(EMBL): T box (TTWTWTTWTT) [1]
FT  374 - 398(EMBL): A/T/C stretch of 25 nt
FT  515 - 1495(EMBL): stronger matrix binding [1]
FT  689 - 694(EMBL): BUR (AATATT) [1]
FT  1261 - 1270(EMBL): T box (TTWTWTTWTT) [1]
XX
EV  in vitro selection of S/MAR [1]
EC  sorghum leaf matrices
XX
DR  EMBL: AF010283; AF010283
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
//