S/MARt DB - S/MAR

AC  SM0000069
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:42:00 (updated); ili
XX
NA  SBI$A1a-5MAR
XX
OS  Sorghum bicolor
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  2281 bp
XX
DE  G001340; open reading frame
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  originally named gene X, located between Sh2 and A1a gene
DC  [1]; supposed to code for a transcription factor due to
DC  the presence of  putative protein-protein interaction and
DC  zinc finger domains [1] [2]
DE  G001345; dihydroflavonol-4-reductase
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001340;
open reading frame
G001345;
dihydroflavonol-4-reductase

XX
SQ  GAATCGGACTAAAGAAATTATTAGGTTTTTATTTTCTGTTCATCCTGCCGCCGTCGCGTC
SQ  GCTACGGAAGTCGTTGTTCATCTCGGGCCTTGTTTACTTCCTGAATTTTTTTTTGCAAAA
SQ  TGCCACTATAGTACTTTCGTTTGTATTTGACAATTGTTATCTAATCATAGACTAATTAGG
SQ  TTCAAAAGATTCGTCTTGCTAATTACATGCGAACTTTGTAATTAGTTATTTTTTATCTAT
SQ  ATTTAATGCTCTATACATGTGCCACAAAATTCTATGTGACGAGGAAACTTTAACATTTTG
SQ  CAAAAGAAAAAAGTCTACTTCACCTCTTCAACTATGGGGATGGACTACTTAACCCCTTCA
SQ  ACTTTAAAACCGGAAGTTTTTCCCTTGAACTTTCCAAAACCGTTCAAATAGCTCCCTCAG
SQ  GCGGTTTTCAAAAGTGGTTTTGCTACCGTAATCATGGTTTTGCTACAGTGGCAGCAGTTT
SQ  TGTCTTTTTCGTTTTTATTTATTTCAGTTATCTTTGAAAAATCGTAGTAAATCATAGAAA
SQ  AAGCATAAAATAAAAAATCAAATTTTGTTGGACTCCGTATGAGTAGATCTATACAGTGAA
SQ  TACATAATATGACATACTTTAGTACAGAGTTTTTGTTATAGATTTTACAGAAAATAATAT
SQ  GGCAATTTTGATCTATTATTTTCTATAAAATCTACAATAAAAACTTTATATTAAAGTATA
SQ  TTATATTATATATCCACCGTATAGATTTACTTATATAGAGTCCAACAAAATTAGAATTTT
SQ  ATTTTATAACTTTTCTATGATTTTTTAAGATTCAACTGAAATAAATAAAAAAGAAAAAGA
SQ  TAAAACAGTCGTCACTGTAGCAAACTATGATTACTGTAGTTAAAATACGAAAACCGCCTA
SQ  AAGAGATTATTCGAACGGTTTTAGAAAGTTTAGATGAAAAACATTCGGTTTTAAAGTTGA
SQ  GAGGGTTAAGTAATCCGTCTTTATAATTATAGGATGAAGTAGACTTTTTTCTTTTATAAA
SQ  ATATTTCGGGAAGTAAATAACGCCGGTGGCTCCCAAGGTGATCGATTTTCAATCTACAAA
SQ  AAACTGCTGTCCGTCCAGGTGGCTGCTCTCGTTCAAGCCGCTCGACGGAGGCCGAAAGGT
SQ  GCTGCTTGCTCTCGTCACGAGACAAGGCAGCGATCTGCTACTTCTGCGCAGTTCAAGTTC
SQ  AGGCATTTTTTGTTTTAAAAAAATTTATAAAAATTTTCAGATTCTTCGTTATATAAATCT
SQ  TTCAGTATATACATAAAACATTAAATATAGATAAAAATAACTATGTGGACAGTTTATCTA
SQ  TAATTTAGGAGATAAATTTTTTACGACTAGTTAGTCCATAATTAGACAATATTTTTCAAA
SQ  TGCAAATGAAAATACTACAGTGTTTATTTTGCACAAAATTTTTTGAACTAAACAAGGCCT
SQ  CAGTTGTGGTGTGATTCACGTCTTGAGGGAACGAATATTATTGATATTATATTTATTTTT
SQ  ATATTTTTGGTCAGATTTGGATTTAAATACGGATAGTGTCAGCTATGTCGGATATGATAT
SQ  TATTGGATATCAATATTATAGTATGCGATTTGAGTATTCGGATATGGATACGGTATCAGA
SQ  TGTTAAATATCTGAACTCAGATACAGACAAATTTAAACGCCTTTAAATAGATTCGGTCTC
SQ  GAATATGATCAGAAAATACCCGTTGTCATCCTTAGTTGTGAGGAAAAGGTGAAATTTGCT
SQ  ACGTGCACATGTGAAGTCTACCAGGCTGCAAGGTTTTGCTAGGATTACACAGAGTAACGT
SQ  ACCTAGATTTCTGCTTATTATATTTCTTCACCATGTCGATAAAGTATGATCTTTCACTAC
SQ  CAGATTGTGACATAAGGTTTGTCTATGGCAAGTCAAGATAAGGACTATTCTTACACATGT
SQ  TAAAGTAGATGGTGCTCTTGATAAATTCGGTAACAAAAAAATTTGTCTTAGGCCCTGTTT
SQ  AGTTCCCCACCAAAAATTTTTCCATCCATCCCATGGAATCTTTGGACACATGCATGAAAC
SQ  ATTAAATGTACATAAAAAATAAACTAATTACACAGTTTGGTTGAAAATCGCGACACGAAT
SQ  CTTTTAAACCTAGTTACTCCATGATTAGCCTTAATTGCTACAGTAACTCACATGTGCTAA
SQ  TAACGGATTAATTATGCTTAATAGATTTGTCTTGCAATTTTCTGACGAGTTATGTAATTT
SQ  GTTTTTTTATTAGTTTCTAAAAACCTCTCTCGATATCCTTCCGACATATCCGATATGACA
SQ  C
SC  EMBL #AF010283; nt 22400-24680
XX
FT  22488 - 22753(EMBL): miniature inverted repeat transposable
FT                       element
FT  22743 - 22767(EMBL): A/T/C stretch of 25 nt
FT  23070 - 23094(EMBL): A/T/C stretch of 25 nt
FT  23402 - 23426(EMBL): A/T/C stretch of 25 nt
FT  23419 - 23424(EMBL): BUR (AATATT) [1]
FT  23612 - 23636(EMBL): A/T/C stretch of 25 nt
FT  23651 - 23871(EMBL): miniature inverted repeat transposable
FT                       element
FT  23767 - 23772(EMBL): BUR (AATATT) [1]
FT  23873 - 23875(EMBL): BUR (AATATT) [1]
FT  23883 - 23907(EMBL): A/T/C stretch of 25 nt
FT  23898 - 23907(EMBL): T box (TTWTWTTWTT) [1]
FT  24382 - 24406(EMBL): A/T/C stretch of 25 nt
FT  24448 - 24472(EMBL): A/T/C stretch of 25 nt
FT  24621 - 24630(EMBL): T box (TTWTWTTWTT) [1]
XX
EV  in vitro selection of S/MAR [1]
EC  sorghum leaf matrices
XX
DR  EMBL: AF010283; AF010283
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
RN  [2]
RX  MEDLINE; 98133900 PubMed; 9475753
RA  Chen, M., SanMiguel, P., Bennetzen, J. L.
RT  Sequence organization and conservation in sh2/a1-homologous
RT  regions of sorghum and rice
RL  Genetics 148:435-443 (1998)
//