S/MARt DB - S/MAR

AC  SM0000070
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 13:43:00 (updated); ili
XX
NA  SBI$A1b-5MAR
XX
OS  Sorghum bicolor
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  1161 bp
XX
DE  G001344; dihydroflavonol-4-reductase
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DE  G001345; dihydroflavonol-4-reductase
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G001345;
dihydroflavonol-4-reductase
G001344;
dihydroflavonol-4-reductase

XX
SQ  AATCAGGCTATGATCCTTTAAGCAATCTTGTAGTACTCATGTAGCTCTACTCAATGGAGC
SQ  AATTGGTTGGCCAAATTGTCAAACAAATCGGGAGTTGAACGTCGACGAACTTCAGGTTTC
SQ  AGTCAGTGCCGATGGCCATTGCCGAGCTCGATTTAGTCAGGGCAGAGGCCAGGCGCCGAC
SQ  GCGTGGATCGCCCCATGGCGGTCGTACGTCGACGATGACCCCACCTATCAGCCCAGGAGC
SQ  GCTCCCATGACCGCCACGACACGCCCTGAGCGACGACAGGCCCTCATTTCCCTTCTCTGC
SQ  CACTCGCCATCGTCCTTAGGAGCTCCGTCGCGACATCGGCCGGCTCGAACTCGCTCTTCG
SQ  TCGCATCTCCGGCCAAACCACCCCGCCCAGAGCTTCGCCAGAGCGTCCTCTACCCCGGTG
SQ  TCAACCCCATTGCAGCAGCCGAGCATAGGTGGGGCGGCATTGCCGAGCTCCTCGTGTTTC
SQ  CTACCTCGCCGGAGTTCCGCCGAGCTCACTCGCGACGTGGCCAGGGCTCTTTGGTCCACC
SQ  GTTTCTTATCATTCTTGTCACATCGCTTTCTCTTGGCTCACTGATGCTCGTCGTTAACCT
SQ  CTATCGCCTTCTCTCCAGCTGAGCATGCCGGCGGCCAGCCCGCAGCCGCCATTGGCGCCG
SQ  CCGAGCACCATAGAGCTCGATAGAGTTAGGGTAAAGTACCTCGTTAGTCCGCCTTGATGA
SQ  GAGGAACACGACCGTGCCCTTGGATTCCGCCGAGACCTCGCCATCGTCGAGTTCTTCGGC
SQ  GACGAGCTCGTCTCTGTTCTCTGTGTTACTGTCGAGTGGGTCCCGCTGACCTGTGGGGTC
SQ  CTCTTGTCAGTCCCTCACCCTCTCTCTCTCATTTGAATTTGGCAGATCCTGTGCTGTTTT
SQ  TGCAAAATTTATATCTTGAGTTCAAATTGGGCGATTCAAATTTTCTCGTGCTCCTGTGTT
SQ  AGTCTAGTTTTTAATAAAATTATGAAATATGCCATATCTTACAGAAATAATTAGTTATAA
SQ  ATTATCTCTTTTATTCCCTAATAAAAAGAGGAGAATTATATCTTTAGATCTGTAAGTTCT
SQ  ATGGTCATGAAACTTTAGGGAGATGATACTTGTGCTATGAGTTGGCGCTGGTAAATAGTT
SQ  CATGATTTTTGGATCCTGTAT
SC  EMBL #AF010283; nt 32500-33660
XX
FT  33514 - 33538(EMBL): A/T/C stretch of 25 nt [1]
XX
EV  in vitro selection of S/MAR [1]
EC  sorghum leaf matrices
XX
DR  EMBL: AF010283; AF010283
XX
RN  [1]
RX  MEDLINE; 98108012 PubMed; 9443968
RA  Avramova, Z., Tikhonov, A., Chen, M., Bennetzen, J. L.
RT  Matrix attachment regions and structural colinearity in the
RT  genome of two grass species
RL  Nucleic Acids Res. 26:761-767 (1998)
//