S/MARt DB - S/MAR

AC  SM0000072
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  RICE$NB-2
XX
SY  OSMAR, 
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  366 bp
XX
SQ  AATTCACAGTTGTACATGCCAGGAGGCAGTTTGATTATGATAGGATAGGAGGCAGCTTCT
SQ  TTCTTAGAGTATATATAATCATTGATTTATAATCAGATGATTGCGTCTTTTTTCAGGAAG
SQ  CCAAGAAAGTATCCAAACCTTACATTGATCAAGTTGCTAAGGCCACTAAGCCACATGTCG
SQ  AGAAAATTACGAATTTATTTGAAGCCTTATACAAAAAGAGCAGTCCATATATATGGAAAT
SQ  TTTCTTGAGAAGGCTACAGCTTATCATCAACAGGTGATTGTTATTTCTTTTTTCCCTTCC
SQ  ATTTTTTCCTATGCATTGCAGCTTATTGGTTTACATACTTTATGCTTCTGCCATACTTCC
SQ  CCAATT
SC  EMBL #X95271
XX
FT  64 - 78(EMBL): lower strand: similarity to topoisomerase II
FT                 consensus [1]
FT  138 - 152(EMBL): similarity to topoisomerase II consensus
FT                   [1]
FT  206 - 215(EMBL): similarity to T box [1]
FT  281 - 290(EMBL): similarity to T box [1]
FT  318 - 348(EMBL): hairpin loop structure [1]
XX
CP  (suspension cultured cells from embryo)
XX
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: X95271; OSMAR
XX
RN  [1]
RX  MEDLINE; 98024654 PubMed; 9360323
RA  Nomura, K., Saito, W., Ono, K., Moriyama, H., Takahashi,
RA  S., Inoue, M., Masuda, K.
RT  Isolation and characterization of matrix associated region
RT  DNA fragments in rice (Oryza sativa L.)
RL  Plant Cell Physiol. 38:1060-1068 (1997)
//