S/MARt DB - S/MAR

AC  SM0000074
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$CSPB-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1233 bp
XX
LO  14q11.2
DE  G001405; cytotoxic serine protease B
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1

G001405;
cytotoxic serine protease B

XX
SQ  GGATCCCATTCTCCTTGATGTACTAATTTTTCTTTAAAAGTGATAATAATAGCTCCCATT
SQ  TAGAATTTTTAAATAACACAACAAATGTAAAGTAACTAATGTGTCCTCTGGATCATGGTA
SQ  AGTAATGAATAAATTTAACTCCCTTTACCTTCTCCCTTTGCTATTTTTTCCATGCTAGGA
SQ  TTTATACATTTTTAAAAAACTAAATCTGCTATCAAATGACAGCTTTAAATTTACTTTTTA
SQ  AAATTTGTTATTGTATATATTTATGGGGTATAAAGTGATGTTATGATATATATATACACA
SQ  ATGTACACTGATTAAATCAAGCCAATTAACATTTTATCATCTCAAATACTTAACATTTTT
SQ  TGTAGTGAGAACATTTGAAATTTACTTTTAGCAATTTCAAAACATACATTATTATTATTA
SQ  ACTATAGTCACCATGATGTACCATAGATCTTTAAAAACTTATTCTTCCTGCCTAACTGAA
SQ  ACTTTGTACTCTTTGACTAACATCTTTTCATTCCCCCACTTCCCAGCCTCTGGTAATCAC
SQ  CATTACACACTCTGCTTCTATGAGTTCAATTGCTTTAGACTCCACGTAATAAATGAGATC
SQ  ATGCAGCATTTGGCTTTCTGTGCCTGGCTTATCCTTGCTTAGCATGGTGTCTTACAGGTT
SQ  CATCCATGTTGCAACAAATAACAGAATCTCATTCTTTGTTAAGGCTGAATACTATTCCAT
SQ  TGGGTATATATACCACATTTTCCTTATCCATTAATCCACTGATGGACCCTTAGGTTGTTG
SQ  ATTCCATATATTGGCTATTGTAAATAGTGCAGCAATGAACATGAGAGTGCAACTATCTCT
SQ  TCAATGTACTGATTTCGAATCCTTCGGATCTATCTCAGAAGTGAGATTGCAGGATCATAT
SQ  AATTCTACTTTTAGTCTTTTGAGGAGCTCCATACAGCTTTCCATATGGCCATACTAATTA
SQ  CATTCTCATCAACAGTGTACAATGGTTTCCTTTTCTCCACATCCTCACCAACATTTATAA
SQ  TTTTTTGTCTTTTTGATAATAGCCATCTGACAGGTGTAAAGTGATAGCTCATTGCAGTTT
SQ  TAATTTGCATTTTTTGATGATTAGTAATGTTGAGAATTTTTTCATATATCTCTTGGCCAG
SQ  TTGCATGTCTTCTTTGGAAAAATGTCTATTCAGTTCCTTTGCCCATTTTTTAATTGGGAT
SQ  TTTTGGTTTCTTGCTATTGAGTTGTTTGAATTC
SC  EMBL #M62716
XX
SF  contains A-box motifs, T-box motifs, other AT-rich motifs,
SF  vertebrate topoismerase II consensus site and sites similar
SF  to the yeast ARS consensus [1]
XX
CP  lymphoid and erythroid cell lines [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: M62716; HSCSPBAA
XX
RN  [1]
RX  MEDLINE; 92119280 PubMed; 1732006
RA  Hanson, R. D., Ley, T. J.
RT  A-T-rich scaffold attachement regions flank the
RT  hematopoitic serine protease gens clustered on chromosome
RT  14q11.2
RL  Blood 79:610-618 (1992)
//