S/MARt DB - S/MAR

AC  SM0000076
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  CHA$DHFR-3MAR1
XX
OS  chinese hamster, Cricetulus longicaudatus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha;
OC  cricetidae; cricetinae; cricetini.
XX
SZ  549 bp
XX
DE  G001234; dihydrofolate reductase
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  locates to the intron between exons 4 and 5 [1]
XX
SQ  TATACGTGAATAGTTTTTCTTCCCTCTGTGTGTTTTAAAATAGTTACTAATGCTTTCTTG
SQ  GATCTGCATTTAGGAGTTATCCTTTCCATTAAAAATATAAGCTGTTTCTTCCAAGGCGAC
SQ  TCCTGGGCGTGGAGCCTACCCTGGGGTATGGTTGATAAACACAGTGTCACTGTACATTGT
SQ  TAGTTATAAATTATATAACTAATTTTAATTATAAAATTAACACTAATTATAATAGCATTA
SQ  TTAATGAAATTAACATTGATTATAATAAAACAACATTAATAATAAAATTAACATTGTAGA
SQ  CACTGGCTTGGAGTGCTATTAACCAAAACAGGCTGAGTGCCATTATTAGCAACAAGAGGC
SQ  AAGATGATTTCCCTGCTTACAGAGAAATGGGGGCATTTTTAGGTAATGACAGAGTAATAG
SQ  GTGTACTGATGGGGTAGGAGACATGGCTCAACAGTTAAGCTCTTGCTACACAGTTATTAG
SQ  GACCGATTCAGATCCTAGCACCCACATAAAAGCAAAAAGGGCATCCTGTGAACTTCTCAG
SQ  TTCCAACTC
SC  EMBL #X06654
XX
FT  170 - 301(EMBL): cluster of repeats [1]
FT  173 - 424(EMBL): main SAR-2 region [1]
FT  173 - 178(EMBL): similarity to Drosophila topoisomerase II
FT                   site [1]
FT  180 - 233(EMBL): region with hairpin loop forming elements
FT                   [1]
FT  252 - 257(EMBL): similarity to Drosophila topoisomerase II
FT                   site [1]
FT  272 - 277(EMBL): similarity to Drosophila topoisomerase II
FT                   site [1]
XX
FF  incomplete attachment was observed in interphase nuclei
FF  [1]; attachment is lost during metaphase [1]; not
FF  detected in [2]
XX
CP  CHO-UK3 [1]; TS8A, a fibroblast cell line [1];
CP  CHO-UA21 [1]; CHO-KI [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: X06654; MASAR2
XX
RN  [1]
RX  MEDLINE; 88118962 PubMed; 3430625
RA  Kaes, E., Chasin, L.A.
RT  Anchorage of the chinese hamster dihydrofolate reductase
RT  gene to the nuclear scaffold occurs in an intragenic region
RL  J. Mol. Biol. 198:677-692 (1987)
RN  [2]
RX  MEDLINE; 89219000 PubMed; 3244360
RA  Dijkwel, P. A., Hamlin, J. L.
RT  Matrix attachment regions are positioned near replication
RT  intiation sites, genes and an interamplicon junction in the
RT  ampified dihydrofolate reductase domain of chinese hamster
RT  ovary cells
RL  Mol. Cell. Biol. 8:5398-5409 (1988)
//