S/MARt DB - S/MAR

AC  SM0000077
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 14:05:00 (updated); ili
XX
NA  GG$GLOBA-3MAR
XX
OS  chick, Gallus gallus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; aves;
OC  neornithes; neognathae; galliformes; phasianidae
XX
SZ  967 bp
XX
DE  G000046; alphaA-globin
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  about 2000 bp downstream to the alpha-globin A gene [1]
DE  G000047; alphaD-globin
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -2
DE  G001169; pi-globin
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -3

G001169;
pi-globin
G000047;
alphaD-globin
G000046;
alphaA-globin

XX
SQ  CCGGCTAGGCAGAGCTGGGCACGGTGTGGGAACAGGAACCCTGCCTAGGCCCCTCACCCT
SQ  CTTCCTACAATCATAGAAATCATAGAAACACAGAATGGTTTGGGTTTGGAAGGGACCTTA
SQ  CAGCCCCCAGCTCCACCCCTGCTGTGGGCTGGCTGCCCCCACCAGCTCAGGCTGCCCAGA
SQ  GCCCCTCCATGGCCTTGGGCACATCCAAGGATGGGGCACTCACAGCTCCGGGCAGCAGTG
SQ  CCATCACGTCACTGCCCTCTATGTGAAGGATTTCCTCCTCACATCTTACCTAAATCTCCC
SQ  CTCTTTTGGTTTAAAAGCATTCCCTCTCGTCCTCTCACTATCTACCCGTGTAAAAAGAAG
SQ  ACAAGAGAAGGCAAGCATCCTAGAGGAGTTTAGCAAGAATTTCCCATTCAAAATGTACTT
SQ  CCTCATTTAGCAAAGAAGAAAACACAGAATTTATCTCCTGAGAGCCAATTGTAACATACC
SQ  ACTTGAGATCCTCTTGATAGAGAGACGAGGGAGAGCATCACCTGCTTACAAAAGGTTCTT
SQ  CTACGTTTGCATCTGACACTGGCATTCAGTAGGCCAATAGCAAAACCCATTATTGGTGCA
SQ  ACCTATAGGTCTTCTGAAAAAATCCTGTCAAAGCAGCTTGTTTGCCTTAGCTTGGCCAGT
SQ  TTTTCTTTCCTAAATGTCAGCCTGAACTGCTCTCTCTGATATATCCCAACCATTTTTAAC
SQ  CCAACGCTTTGGGTTGCTCACAGCTCTTCCAGCTCAGATCCATCTATCTGAGGTTTTAAG
SQ  TAATGTATTCTCTATTACAACACATAAGGTATTGATGAAGGAACAGTGAATAATGATGTT
SQ  GAACCAAGAACTGGAATCTGTCACAGAAGGAAAACAGACTCATCTGAAATATTCATTCTT
SQ  GGCAAAAGCAGTGCTTATTCATCTCTTACTTCAATTAAATGTCCACTGTTAGTTGTGAAT
SQ  TGAAGTT
SC  EMBL #M58749
XX
FT  36 - 347(EMBL): repetitive sequence of CR1 type [1]
FT  230 - 243(EMBL): putative binding site for TGGCA-binding
FT                   protein  [1]
FT  357 - 368(EMBL): similarity to HTLV III LTR [1]
FT  432 - 442(EMBL): polypurine tract [1]
FT  660 - 671(EMBL): polypyrimidine tract [1]
FT  776 - 790(EMBL): putative Drosophila topoisomerase II site
FT                   [1]
FT  826 - 840(EMBL): putative Drosophila topoisomerase II site
FT                   [1]
FT  911 - 925(EMBL): putative Drosophila topoisomerase II site
FT                   [1]
FT  932 - 946(EMBL): putative Drosophila topoisomerase II site
FT                   [1]
XX
CH  boundary [3]
XX
FF  repetitive sequence of CR1 type closely linked to an
FF  AT-rich region may be indicative for domain boundaries
FF  [1]; delimits a loop of about 20 kb [3]
XX
EV  in vivo selection of S/MAR [2]
XX
BF  SB000047; TGGCA-binding protein [1]
MM  DNase I footprinting; 
SO  erythroblast; chicken
QA  5
XX
DR  EMBL: M58749; GGHBBMAS
DR  EMBL: X51600; GDGLO3
XX
RN  [1]
RX  MEDLINE; 90174957 PubMed; 2308840
RA  Farache, G., Razin, S.V., Targa, F.R., Scherrer, K.
RT  Organization of the 3'-boundary of the chicken alpha globin
RT  gene domain and characterization of a CR 1-specific protein
RT  binding site
RL  Nucleic Acids Res. 18:401-409 (1990)
RN  [2]
RX  MEDLINE; 90377225 PubMed; 2398893
RA  Farache, G., Razin, S.V., Rzeszowska-Wolny, J., Moreau, J.,
RA  Recillas, T., Scherrer, K.
RT  Mapping of structural and transcription-related matrix
RT  attachment sites in the alpha-globin gene domain of avian
RT  erythroblasts and erythrocytes
RL  Mol. Cell. Biol. 10:5349-5358 (1990)
RN  [3]
RX  MEDLINE; 92020883 PubMed; 1656447
RA  Razin, S. V., Petrov, P., Hancock, R.
RT  Precise localization of the alpha-globin gene cluster
RT  within one of the 20- to 300-kiolobase DNA fragments
RT  released by cleavage of chicken chromosomal DNA at
RT  topoisomerase II sites in vivo: evidence that the fragments
RT  are DNA loops or domains
RL  Proc. Natl. Acad. Sci. USA 88:8515-8519 (1991)
//