S/MARt DB - S/MAR

AC  SM0000078
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 14:14:00 (updated); ili
XX
NA  GG$GLOBA-5MAR1
XX
SY  alpha 5HR, 
XX
OS  chick, Gallus gallus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; aves;
OC  neornithes; neognathae; galliformes; phasianidae
XX
SZ  1737 bp
XX
DE  G000046; alphaA-globin
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 3
DE  G000047; alphaD-globin
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 2
DE  G001169; pi-globin
DP  Direction: 5'; 3500 - ; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DC  conflict: MAR locates between main transcriptional start
DC  site and the pi globin gene in [1] whereas major
DC  transcriptional start site is between the MAR and the pi
DC  globin gene in [4]

G001169;
pi-globin
G000047;
alphaD-globin
G000046;
alphaA-globin

XX
SQ  GCGGCACGGGGCGGCCCCGGGCCCGGCGCGCACTTACTGGCCTTGGCGGCGGGGTGCTCG
SQ  GCGCCGCGCTGGAAGGGGAAGCGGAAGAGCAGCTTGTTGCCGCGGCTGCCCGAGCTCACA
SQ  AGGATAACGCTGATGGGGCTGGTGCTCTCGCCCATGCCGCCGCGCCACAGCGAGCACCGG
SQ  GCGGGCAACGACGGACGCGGCTCCGCGGAAGGCGGCCCGGCCCGCGCGACTTCCGCTTCC
SQ  GCGCCTCCGCCGCCGCCGCCGGTTCCCCCGGGCCGCGGCCGAGCGGCGGGGCGGAGCTGC
SQ  GGGCACAGCGCTCCCCGGGCAGGTCGCGCTCAGAGGCCGGGCCGCCGCTTCAGCGCCGTG
SQ  CCCTCAGTGCGGCCCAGCGCCGTGCCCGCAGCGCTGCCCACACGCCCTCGGGGTGCCCCA
SQ  CGGCTGCTGCTTGCTCCCGGTGCCCGCCGTTCCTCCCAGCACCTCGCAGTGCAGCCGTGC
SQ  CTGAAGTGCAGCCCAGCACCTCACACCTCAGCCCCGGGCTCCCAGTACGACCAGCAGGTC
SQ  ACGTTGGAGTCTCTTGTCCTCAAGACTGCGCAGTGTCTCACCTTTGAGCCTTGTGCCCCC
SQ  CATTCAGCCCAGCACATCACACTGTAGCCCTTACACCCTCACCACAGCACAGCACCTCAC
SQ  GTTCAGGCCCCAGCACGTCAAGATGGAGCCCTGTGCCCCCAGACAGCCAGCATGGAACCA
SQ  TCAAATCCTTAGAGTTGGAAGATGTCTGAATCCTTGTGCCCCCAGTTCAGCCCGGCACCT
SQ  CTCACACCCCACTCAACACTCTTCAGCCAAGAGCCTACAGCTCAACCCAGCACCTCACGC
SQ  CACCCAGCAGCACTCCCGCCATCAGCCCAGTGCCCCCAGTCCGGATCGGTACCTCTCATG
SQ  CCCATGCACAGTGCACCAGATCAGCCTAGCACCACTAGTTCATTCCAGCACCTCACGTGC
SQ  CCACAGCCAACCACTCCAGCACCCCCGGTGCCCTAGTCACACCTCTCCGCTGCCTCAAGG
SQ  TTCATTCCCACCTCTTCCCACATCCCCTCACACCCCCTCATTATTTTCATGTCTCGCAAT
SQ  CTCCTTTGGTCACTTGGAGTCATTCAGTTATGACAACTCCAGAACTAGAAGCTGCTGGCC
SQ  AGCAGCAAGTGCCACAAACTGTGTTCCCCCGGCAGCTCTTCTGGCTCATTTGTCTTATTG
SQ  TGTGTCCAGCTGAGATCAGAAAGCTATCGGCAATTATGTCAGAGGATGGCCCAGTTTTTC
SQ  ACATAGATTTGTCTGTATTTGATAGCAATATTTAGTATTTGGTGCTCCGAGTATCCCCAC
SQ  TCTGGATTTTTCTCTGCAAGATTCTTCCCTTGGACTTCAGGCAGAGAAGGGGACTGAAAG
SQ  GGAGATGAGCACCCGCAGTGAGGGCTTAATCTGCACGGCCATTCTCTGCAAGGCAGGTGA
SQ  TAACAACTGAAGCAAGAGAAGCTGTCATTGAGGGGAGAGAGTTGTTGGTGAGCGATTAAA
SQ  GAGCAGTCACATTATCACAGCAGAGCATTCATCGTGGCCCAGTGCTGGGGAGCTACGTTA
SQ  GAATTGCCCAGTGTGTCTGCTTCCCAGCATAACTATGCATTCTTCAATTAAAAAACTGCA
SQ  GGCATGTTTGCCATTTCCAGCTCTCGGAGATGAGTTAAAGCAAAGCTCTGGAAACCTGCA
SQ  AGCTCTCTGAGTGCTAGTAGAATGAAATGAAAGAATAAAGCCAGATATAGATTCTGC
SC  EMBL #M34465
XX
FT  1 - 500(EMBL): GC-rich [2]
FT  205 - 222(EMBL): homology to SV40 ori [2]
FT  247 - 266(EMBL): homology to SV40 ori
FT  279 - 411(EMBL): homology to SV40 ori, may form a
FT                   hairpin-like structure [2]
FT  501 - 1300(EMBL): moderately GC-rich, multiple imperfect
FT                    repeats [2]
FT  926 - 952(EMBL): cleavage by bovine topoisomerase II in the
FT                   presence of VM-26 [3]
FT  1210 - 1340(EMBL): bend [6]
FT  1212 - 1343(EMBL): matrix binding [3]
FT  1222 - 1239(EMBL): site for avian topoisomerase II [3]
FT  1311 - 1328(EMBL): site for avian topoisomerase II, cleavage
FT                     by bovine topoisomerase II in the presence
FT                     of VM-26 [3]
FT  1563 - 1580(EMBL): cleavage by bovine topoisomerase II in the
FT                     presence of VM-26 [3]
FT  1588 - 1614(EMBL): AT-rich [2]
FT  1600 - 1719(EMBL): matrix binding [3]
FT  1610 - 1627(EMBL): site for avian topoisomerase II, cleavage
FT                     by bovine topoisomerase II in the presence
FT                     of VM-26 [3]
FT  1670 - 1687(EMBL): site for avian topoisomerase II, cleavage
FT                     by bovine topoisomerase II in the presence
FT                     of VM-26 [3]
FT  1681 - 1677(EMBL): in vivo footprint [7]
FT  1684 - 1684(EMBL): double-S1 cleavage site [7]
FT  1695 - 1719(EMBL): AT-rich [2]
FT  1722 - 1732(EMBL): in vivo footprint [7]
FT  1735 - 1735(EMBL): double-S1 cleavage site [7]
XX
SF  contains binding sites for several sequence-specific
SF  factors [2]; cleaved by bovine topoisomerase II in the
SF  presence of VM-26, but not in the absence of the drug
SF  [3]; contains DNase I hypersensitive site [4]
XX
TP  permanent [2]
XX
FF  contains origin of replication [2]; contains a
FF  transcriptional enhancer-like element which is not
FF  tissue-specific [5]; targeted by some proteins present
FF  in nuclear extracts [5]; mediates permanent attachment
FF  to the nuclear matrix [2]; delimits a loop of about 20
FF  kb [4]
XX
CP  erythrocytes, sperm & cultured fibroblast cells [2]
XX
EV  genomic in situ DNAse I footprinting [7]
EC  (AEV)-transformed
EV  in vitro selection of S/MAR [3]
EV  in vivo selection of S/MAR [1]
XX
BF  SB000043; topoisomerase II [3]
MM  topoisomerase II cleavage assay; 
SO  thymocyte; bovine
QA  6
XX
DR  EMBL: M34465; GGAGLOB
DR  EMBL: X54965; GSP5HR
DR  EMBL: M58748; GGHBBM01
XX
RN  [1]
RX  MEDLINE; 90377225 PubMed; 2398893
RA  Farache, G., Razin, S.V., Rzeszowska-Wolny, J., Moreau, J.,
RA  Recillas, T., Scherrer, K.
RT  Mapping of structural and transcription-related matrix
RT  attachment sites in the alpha-globin gene domain of avian
RT  erythroblasts and erythrocytes
RL  Mol. Cell. Biol. 10:5349-5358 (1990)
RN  [2]
RX  MEDLINE; 90226396 PubMed; 2328015
RA  Kalandadze, A.G., Bushara, S.A., Vassetzky jr, Y.S., Razin,
RA  S.V.
RT  Characterization of DNA pattern in the site of permanent
RT  attachment to the nuclear matrix located in the vicinity of
RT  replication origin
RL  Biochem. Biophys. Res. Commun. 168:9-15 (1990)
RN  [3]
RX  MEDLINE; 91254285 PubMed; 1645958
RA  Razin, S. V., Vassetzky, Y. S., Hancock, R.
RT  Nuclear matrix attachment regions and topoisomerase II
RT  binding and reaction sites in the vicinity of a chicken
RT  replication origin
RL  Biochem. Biophys. Res. Commun. 177:265-270 (1991)
RN  [4]
RX  MEDLINE; 92020883 PubMed; 1656447
RA  Razin, S. V., Petrov, P., Hancock, R.
RT  Precise localization of the alpha-globin gene cluster
RT  within one of the 20- to 300-kiolobase DNA fragments
RT  released by cleavage of chicken chromosomal DNA at
RT  topoisomerase II sites in vivo: evidence that the fragments
RT  are DNA loops or domains
RL  Proc. Natl. Acad. Sci. USA 88:8515-8519 (1991)
RN  [5]
RX  MEDLINE; 91354301 PubMed; 1883377
RA  de Moura Gallo, C. V., Vassetzky, Y. S., Recillas Targa,
RA  F., Georiev, G. P., Scherrer, K., Razin, S. V.
RT  The presence of sequence-specific protein binding sites
RT  correlate with replication activity and matrix binding in a
RT  1.7 Kb-long DNA fragment of the chicken alpha-globin gene
RT  domain
RL  Biochem. Biophys. Res. Commun. 179:512-519 (1991)
RN  [6]
RX  MEDLINE; 93101144 PubMed; 1465110
RA  Krajewski, W. A., Razin, S. V.
RT  Organization of specific DNA sequence elements in the
RT  region of the replication origin and matrix attachment site
RT  in the chicken alpha-globin gene domain
RL  Mol. Gen. Genet. 235:381-388 (1992)
RN  [7]
RX  MEDLINE; 94240149 PubMed; 8183924
RA  Targa, F. R., Razin, S. V., de Moura Gallo, C. V.,
RA  Scherrer, K.
RT  Excision close to matrix attachment regions of the entire
RT  chicken alpha-globin domain by nuclease S1 and
RT  characterization of the framing structures
RL  Proc. Natl. Acad. Sci. USA 91:4422-4426 (1994)
//