S/MARt DB - S/MAR

AC  SM0000082
XX
DT  1.1.1999 00:00:00 (created); ili
DT  28.5.2002 11:21:00 (updated); ili
XX
NA  HS$kappa-MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
HO  mouse, rabbit kappa MAR [1]
XX
SZ  1001 bp
XX
LO  2p11
DE  G000319; immunoglobulin kappa light chain locus
DP  Direction: 5'; 1081 - 81; Pos 1: enhancer
DN  Internal: y; 
DC  locates between joining and constant regions
XX
SQ  ATTTCAGAAATAAAATTCACATTCATTATGATATCTCATTAGTGAAAATTTCCATTAGGG
SQ  GATTGTAAATAATTTAAAGCTTTTTTTTTTTCAGTGCTATTTAATTATTTCAATATCCTC
SQ  TCATCAAATGTATTTAAATAACAAAAGCTCAACCAAAAAGAAAGAAATATGTAATTCTTT
SQ  CAGAGTAAAAATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAATT
SQ  TGGCATTAAATACCATTAAGGTATATTAACTGATTTTAAAATAAGATATATTCGTGACCA
SQ  TGTTTTTAACTTTCAAAAATGTAGCTGCCAGTGTGTGATTTTATTTCAGTTGTACAAAAT
SQ  ATCTAAACCTATAGCAATGTGATTAATAAAAACTTAAACATATTTTCCAGTACCTTAATT
SQ  CTGTGATAGGAAAATTTTAATCTGAGTATTTTAATTTCATAATCTCTAAAATAGTTTAAT
SQ  GATTTGTCATTGTGTTGCTGTCGTTTACCCCAGCTGATCTCAAAAGTGATATTTAAGGAG
SQ  ATTATTTTGGTCTGCAACAACTTGATAGGACTATTTTAGGGCCTTTTTAAAGCTCTATTA
SQ  AAACTAACTTACAACGATTCAAAACTGTTTTAAACTATTTCAAAATGATTTTAGAGCCTT
SQ  TTGAAAACTCTTTTAAACACTTTTTAAACTCTATTAAAACTAATAAGATAACTTGAAATA
SQ  ATTTTCATGTCAAATACATTAACTGTTTAATGTTTAAATGCCAGATGAAAAATGTAAAGC
SQ  TATCAAGAATTCACCCAGATAGGAGTATCTTCATAGCATGTTTTTCCCTGCTTATTTTCC
SQ  AGTGATCACATTATTTTGCTACCATGGTTATTTTATACAATTATCTGAAAAAAATTAGTT
SQ  ATGAAGATTAAAAGAGAAGAAAATATTAAACATAAGAGATTCAGTCTTTCATGTTGAACT
SQ  GCTTGGTTAACAGTGAAGTTAGTTTTAAAAAAAAAAAAAAC
SC  EMBL #X67858
XX
SF  shares sequence similaity with its mouse and rabbit
SF  counterparts [1]
XX
BF  SB000017; hnRNP-U [2]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
BF  SB000089; p300 [2]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
XX
DR  EMBL: X67858; HSIGKA
XX
RN  [1]
RX  MEDLINE; 93027217 PubMed; 1408808
RA  Whitehurst, C., Henney, H.R., Max, E.E., Schroeder, H.W.,
RA  Stuber, F., Siminovitch, K., Garrard, W.T.
RT  Nucleotide sequence of the intron of the germline human K
RT  immunoglobulin gene connecting the J and C regions reveals
RT  a matrix association region (MAR) next to the enhancer
RL  Nucleic Acids Res. 20:4929-4930 (1992)
RN  [2]
RX  MEDLINE; 21907223 PubMed; 11909954
RA  Martens, J. H. A., Verlaan, M., Kalkhoven, E., Dorsman, J.
RA  C., Zantema, A.
RT  Scaffold/matrix attachment region elements interact with a
RT  p300-scaffold attachment factor A complex and are bound by
RT  acetylated nucleosomes
RL  Mol. Cell. Biol. 22:2598-2606 (2002)
//