S/MARt DB - S/MAR

AC  SM0000092
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  HS$SBS-9
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  176 bp
XX
SQ  CTTAACTATTCCCTATTTTGTTAGGCTGAGTTGTCAAGGCTTTTACTTAATTTCTTTCAG
SQ  GCTGTTTAAGTAGTCAAAGTATTCATTAATTTAGAGCTTTCTCCAAATATTTGACATAGA
SQ  CATCATTTTCCTCAATTACCTAGACAGTTCTACGCAAGATAATTTTTTGAGGGATT
SC  EMBL #AF051682
XX
FT  1 - 176(EMBL): A/T/C sequence context [1]
XX
FF  obtained in a search for SATB1 binding sites in vivo [1]
XX
CP  Jurkat
XX
EV  in vitro selection of S/MAR [1]
EC  experiment was mentioned, but not shown [1]
XX
BF  SB000012; SATB1 [1]
MM  assessment of the dissociation constant; 13.5 nM
SO  rec(human-E.coli); human
QA  6
XX
DR  EMBL: AF051682; AF051682
XX
RN  [1]
RX  MEDLINE; 98215708 PubMed; 9548713
RA  deBelle, I., Cai, S., Kohwi-Shigematsu, T.
RT  The genomic sequences bound to special AT-rich
RT  sequence-binding protein 1(SATB1) in vivo in Jurkat T cells
RT  are tightly associated with the nuclear matrix at the bases
RT  of the chromatin loops
RL  J. Cell Biol. 141:335-348 (1998)
//